CHMI E.R. Gauthier, Ph.D. 1 CHMI 2227E Biochemistry I Nucleic acids: - structure - physico-chemical properties

CHMI E.R. Gauthier, Ph.D.2 Nucleic acids Discovered in the 1869 by Friedrich Meischer:  Acid material found in the cell’s nucleus;  Called the stuff nuclein; Later work by others showed that nucleic acids were mostly made of:  Phosphorus  Nitrogen  Carbon  Oxygen Two types of nucleic acids exist:  Deoxyribonucleic acid (DNA)  Ribonucleic acid (RNA) BUT: what’s the big deal?

CHMI E.R. Gauthier, Ph.D.3 Hershey and Chase The Waring blender experiment… 32 P in nucleic acids only 35 S in proteins only (Met/Cys)

CHMI E.R. Gauthier, Ph.D.4 Nature of nucleic acids 1. nitrogenated bases 5 nitrogenated bases exist:  Purines: Adenine Guanine  Pyrimidines Cytosine Thymine Uracil

CHMI E.R. Gauthier, Ph.D.5 Nature of nucleic acids 2. sugars Two types of 5-carbon sugars are found in nucleic acids:  Ribose (RNA)  2’Deoxyribose (DNA) Sugar pucker:  2’ endo: C2’ above the ring  3’ endo: C3’ above the ring

CHMI E.R. Gauthier, Ph.D.6 Nature of nucleic acids 3. nucleosides The formation of a covalent bond (glycosidic bond) between the sugar and a nitrogenated base forms nucleosides H Deoxyadenosine Glycosidic bond 1’1’ 9 1 1’1’ Cytidine H

CHMI E.R. Gauthier, Ph.D.7 Purines BaseDNARNA AdenineDeoxyadenosineAdenosine GuanineDeoxyguanosineGuanosine Nature of nucleic acids 3. nucleosides Pyrimidines BaseDNARNA Cytosine DeoxycytidineCytidine ThymineDeoxythymidine- Uracil-Uridine

CHMI E.R. Gauthier, Ph.D.8 Nature of nucleic acids 3. nucleosides

CHMI E.R. Gauthier, Ph.D.9 Nature of nucleic acids 4. nucleotides Nucleotides are nucleosides bearing one or multiple phosphate groups, usually at position 5’ of the sugar; Guanosine 5’monophosphate Deoxythymidine 5’triphosphate Alpha  Beta  Gamma 

CHMI E.R. Gauthier, Ph.D.10 Number of phosphate groups Deoxynucleotide/Nucleotide 1Deoxyadenosine-5’-monophosphate 2Deoxyguanosine-5’-diphosphate 3Adenosine-5’-triphosphate Nature of nucleic acids 4. nucleotides

CHMI E.R. Gauthier, Ph.D.11 Nature of nucleic acids 5. polynucleotides Nucleotides and deoxynucleotides form polymers called polynucleotides The nucleotides are linked together through phosphodiester bonds;  Involves the 3’OH of a nucleotide and the 5’  phosphate of another nucleotide; The order of the bases in a polynucleotide is the primary structure or sequence of the nucleic acid; Polynucleotides have a polarity:  5’ end: the 5’phosphate not involved in a phosphodiester bond  3’end: the 3’OH not involved in a phosphodiester bond;

CHMI E.R. Gauthier, Ph.D.12 Nature of nucleic acids 5. phosphodiester bond  

CHMI E.R. Gauthier, Ph.D.13 Nature of nucleic acids 6. Chargaff’s rules

CHMI E.R. Gauthier, Ph.D.14 Structure of nucleic acids 1. DNA DNA is made of two antiparallel polynucleotide chains (they run in opposite direction); The bases are almost perpendicular to the axis of the structure (tilt of 6 o ); The base are shielded inside the structure, with the sugar-phosphate backbone on the outside; The two chains are held together through hydrogen bonding between nitrogenated bases:  A forms 2 H-bonds with T (AT base pair)  G forms 3 H-bonds with C (GC base pair) This A:T and G:C relationship dictates the complementarity of the two chains:  The nature of the base on one strand dictates the nature of the base on the complementary strand; bases Sugar/phosphate backbone

CHMI E.R. Gauthier, Ph.D.15 Structure of nucleic acids 1. DNA The two polynucleotide chains from a right-handed helix:  Approx 10 base pairs/turn;  Rise: 3.4 Å per base  34 Å per turn  20 Å in diameter  Sugar pucker: 2’ endo  Glycosidic bond: anti Presence of two grooves on the side of the helix:  Minor groove: narrow space between the sugar/phosphate backbones of the 2 chains  Major groove: wide space between the sugar/phosphate backbones of the 2 chains 1 Å (Ångstrom) = 0.1 nm = 1 x m

CHMI E.R. Gauthier, Ph.D.16 Structure of nucleic acids 1. DNA Stability of the helix:  Multiple H bonds between the two chains; 2 H bonds in AT 3 H bonds in GC  Stacking of the bases (e.g. stack of pennies): Stacks of GC stacks are more stable; So, a DNA molecules rich in GC base pairs will be more stable than a DNA molecue composed mostly of AT base pairs

CHMI E.R. Gauthier, Ph.D.17 Structure of nucleic acids 2. DNA/RNA hybrids and RNA duplexes Double stranded RNA molecules follow the same basic rules as DNA molecules:  Complementarity  Antiparallellism However, the 2’OH found in RNA will lead to changes in the structure of the helix:  Wider: 26 Å  Shorter: 11 bp/turn  Rise: 2.6 Å  Bases are tilted (20 o )  Sugar pucker: 3’endo

CHMI E.R. Gauthier, Ph.D.18 Structure of nucleic acids 2. DNA/RNA hybrids and RNA duplexes

CHMI E.R. Gauthier, Ph.D.19 Structure of nucleic acids Java applets: 

CHMI E.R. Gauthier, Ph.D.20 DNA absorbance Nucleic acids absorb light at ~260 nm (due to purine/pyrimidine bases); Usually: pure nucleic acids will give a ratio A 260 / A280 of around 1.8; A 260 / A280 lower than 1.8 are usually interpreted as contamination of the nucleic acids by proteins. WHY??? Rule of thumb: an absorbance of 1 at 260 nm equals:  50 µg / ml of DNA  40 µg / ml RNA

CHMI E.R. Gauthier, Ph.D.21 DNA denaturation Double-stranded (ds) nucleic acids can be made single-stranded (ss) (i.e. denatured) by:  increasing the temperature  decreasing the salt concentration  Chemicals: NaOH/formamide/formaldehyde (break H bonds) Conversely, single-stranded nucleic acids can be made to renature (i.e. anneal) by:  Decreasing the temperature  Increasing the salt concentration This phenomenon can be followed by spectrophotometry:  ss nucleic acids absorb more at 260 nm than ds nucleic acids: hyperchromic shift;

CHMI E.R. Gauthier, Ph.D.22 DNA denaturation The temperature at which 50% of the ds nucleic acid is denature is called the melting temperature (Tm); The Tm is affected by several factors:  Salt concentration: Tm increases with increasing [NaCl];  Hybrid length: Tm increases with length (only for DNA < 150 bp)  G+C content: The more GC the higher the Tm; Tm = 4 (G + C) + 2 (A+T) What is the Tm of the following DNA molecule: 5’ GACTAGATCGATGGCTTCGATACC 3’ 3’ CTGATCTAGCTACCGAAGCTATGG 5’ Hyperchromic shift DNA#1 DNA#2

CHMI E.R. Gauthier, Ph.D.23 DNA denaturation A+T-rich G+C-rich

CHMI E.R. Gauthier, Ph.D.24 Hybridization ss nucleic acids with complementary sequences will anneal when mixed together (hybridization);  DNA-DNA  DNA-RNA  RNA-RNA The annealing will occur even if two strands are not perfectly complementary; However, the Tm will decrease with increasing mismatches; This phenomenon is widely used when studying nucleic acids:  DNA sequencing  PCR  Southern Blot  Northern Blot  FISH analysis  Microarrays

CHMI E.R. Gauthier, Ph.D.25 Agarose gel electrophoresis +- Power Scanning Electron Micrograph of Agarose Gel (1×1 µm)  Polymerized agarose is porous, allowing for the movement of DNA DNA

CHMI E.R. Gauthier, Ph.D.26 Agarose gel electrophoresis DNA molecules of known length Standard curve: Log length vs distance migrated Staining with ethidium bromide Ethidium bromide fluoresces red only when it intercalates between base pairs.

CHMI E.R. Gauthier, Ph.D.27 Southern blot and Northern blot In Southern blot, DNA molecules are run on the gel and probed:  Widely used to study the structure of genes In Northern blot, RNA molecules are run on a gel and probed:  Widely used method to determine the location and level of expression of one’s favourite gene; 32 P-labeled nucleic acid probe is complementary to one of the DNA molecules on the gel Annealing

CHMI E.R. Gauthier, Ph.D.28 Southern blot Genomic DNA cut with restriction enzyme Different allele?

CHMI E.R. Gauthier, Ph.D.29 FISH Fluorescent in-situ hybridization FISH is used to locate the position of a gene of interest on a chromosome; A nucleic acid probe complementary to the gene of interest is labelled with a fluorescent dye, and hybridized to chromosomes (metaphase spread);