Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

How are different sizes of DNA strands separated on agarose gel? Mixture of DNA molecules

DNA separation is based on fragment size Decreasing Size (+) (-) PCR1 PCR2

Size markers and their use to determine size

Size markers and their use to determine size Mobility of a DNA fragment is proportional to the log of its size in bases.

Plot of relative mobility of DNA vs log of size on semi-log graph paper

DNA Ladders Varying concentrations of agarose How does one make a 0.7%, 1.0% & 1.5% agarose gel? Why are there varying concentrations of agarose gels?

DNA Ladders Varying concentrations of agarose Why are there varying concentrations of agarose gels? Higher concentrations provide better resolution for smaller DNA fragments Lower concentrations provide better resolution for larger DNA fragments

Experiment 1 What is an EST?

pT7T3-pac

3 important parts of a vector Origin of replication Selectable marker Cloning sites

Origin of replication: considerations What is an origin of replication? Why do we need one? What properties should it have for easy plasmid DNA isolation?

Replicon Contains all info necessary to begin and end DNA replication Origin of replication (Ori) is a defined location within the replicon where DNA synthesis begins

The ColE1 origin of replication

ColE1 origin RNAII forms the primer for initiation of DNA synthesis RNAI and Rop protein are negative regulatory functions: RNAI binds to RNAII stopping primer formation; Rop protein stabilizes the complex formed by RNAI and RNAII.

The ColE1 origin of replication

RNAI:RNAII interaction

Rop protein negatively regulates the origin of replication by stabilizing the RNAI:RNAII interaction.

Copy number

Why does pT7T3.pac have a high copy number? Point mutation in the origin that alters the initiation of RNAI transcription, such that the RNAI:RNAII complex does not form as well as wild-type. The region of the origin that encodes Rop protein is deleted.

Selectable Marker Ampicillin resistance Ampicillin is a penicillin derivative. Blocks cross linking of the bacterial cell wall causing the cells to burst/lyse. Ampicillin resistance gene encodes a secreted enzyme that cleaves the beta-lactam ring.

Benzyl penicillin b-lactam ring

Mechanism of resistance

Plasmid DNA isolation Separate chromosomal DNA from plasmid DNA Remove protein Remove RNA Easy

Starting material

Lysis and denaturation

Neutralization and centrifugation

Column Silica gel DNA binds at high salt. DNA is eluted at low salt. Removes glycogen and other cellular components.

ESTs Expressed sequence tags? What are they? What do they represent? What do we use them for? What are their advantages?

How is cDNA made? First strand synthesis GCGGCCGCGTTGCTTTTTTTTTTTTTT 3’ 3’ AAAAAAAAAAAAAAAAAAANNNNNNNNNNNN Reverse transcriptase

Second strand synthesis Remove mRNA with OH or enzymatically DNA polymerase I Cut hairpin Add EcoRI adaptors GAATTCGGCACGAGG Cut with NotI and insert into EcoRI NotI of vector

Normalized Library mRNAs accumulate to different levels in a mRNA sample. Normalization is a method of evening out the abundance levels using hybridization.

T7 sequencing primer?

Dideoxy or Chain Termination Method DNA SEQUENCING Dideoxy or Chain Termination Method 1974 Maxam/Gilbert (USA) (Chemical Cleavage protocol) Sanger (England) (natural process of DNA replication) * Phosphodiester bond cannot form with incoming nucleotides leading to termination of DNA synthesis

Sanger Sequencing in 1989

Primer ADD:

Example output

Why is the size of the insert important? A sequencing run may only go 500-700 bases. What might you see and what might you not see?

EST gel

Clipping an EST sequence What are we clipping out? Why do we look for GAATTCGGCACGAGG and GCAACGCGGCCGC? Why do we look for AAAAAAn?

AAAAAAAAAAAAAAAAAAAAAAAA Example GAATTCGGCACGAGG CGCGTTCTTGAAAAGACAGGTAAAATGCGAGTTCCAGAATGGGTAGAATTGTAAAGTCTGCACGATTCAAGGAACTTGCTCCATATGATCCAGATTGGTATTATATTAGATGTGCTGCTTTAGTTCGTCATATTTATATTCGAAGTCCAATTGGTGTTGGAGCAGTAACAAAAATTTTTGGAGGACGCAAACGTAATGGTACTCATCCTAGCCATTTCTGTCGATCGGCAGGTGGTGTTGCTCGCAAAGCTCTTCAGAGCTTGGAACAACTTAAACTCATTGAAAAATCTCCAGTTGGTGGACGTAAACTTACCAGTCAAGGCCGTAGAGATTTAGATCGCATTGCTGCCCAAGTCAAAGCAAAAAGCAAAAAACAACTTAAGTTACAAGAAACTCTTGTTCTCTAATTTCTTTATTTCTATAATAAAAATTAAAAAATCGTACATTTATATTCAAATTTTATTTATTCTACTATTATAAGTTAATTTTAGAAGTCTTAAATAATTTAATGGTAACAAAATATCACAAGACAATGTGCTATTATTTTTTTAATTGTTTATGAATTATCATAATTGAGGAAATTTTTAACTATAAATAGATAAAGTAAGAAATATAAATTTATAATTTATGATTATGTATTTTATATCTAAATGTATTTATTAATCTAAATATAAACAAATATACAT AAAAAAAAAAAAAAAAAAAAAAAA GCAACGCGGCCGC AAGCTTATTCCCTTTAGTGAGGGTTAATTTTAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTC

Example output

What could go wrong 18% of ESTs are in the reverse orientation. Potential of 2 inserts in the clone. What would this look like?

Step into liquid

Clipping a sequence I

Clipping Sequence II

Clipping Sequence III

Clipping Sequence IV

Step into liquid