UK HIV Drug Resistance Database

Background (1) HIV drug resistance testing first became available in UK in At least 10 laboratories currently perform testing Variety of in-house and commercial systems – all based on DNA sequencing of the pol gene British HIV Association guidelines recommend resistance testing at treatment initiation and at each therapeutic failure

Background (2) Recognised that routine resistance tests represented a valuable scientific resource but that reports were just being filed in patients’ notes UK HIV Drug Resistance Database was established in 2001 as central repository of resistance tests performed as part of routine clinical care

Study Governance (1) Overseen by UK Collaborative Group on HIV Drug Resistance which includes representatives from –each laboratory contributing resistance data –major clinical centres –academic specialists –MRC Clinical Trials Unit (study coordination, site of database) –UCL Centre for Virology (main bioinformatic input) –UK CHIC study (clinical data that links to resistance data) –HPA (surveillance expertise)

UK Collaborative Group on HIV Drug Resistance Steering Committee David Dunn, Esther Fearnhill, Hannah Green, Kholoud Porter, (MRC Clinical Trials Unit), Rob Gifford, Paul Kellam, Deenan Pillay, Andrew Phillips, Caroline Sabin (Royal Free and University College Medical School), Sheila Burns (City Hospital, Edinburgh), Sheila Cameron (Gartnavel General Hospital, Glasgow), Pat Cane (Health Protection Agency), Ian Chrystie (St. Thomas’ Hospital, London), Duncan Churchill (Brighton and Sussex University Hospitals NHS Trust), Valerie Delpeche (Health Protection Agency, London), Philippa Easterbrook, Mark Zuckerman (King’s College Hospital, London), Anna Maria Geretti (Royal Free NHS Trust, London), David Goldberg (Scottish Centre For Infection and Environmental Health), Mark Gompels (Southmead Hospital, Bristol), Tony Hale (PHLS, Leeds), Andrew Leigh-Brown (University of Edinburgh), Anton Pozniak (Chelsea & Westminster Hospital, London), Gerry Robb (Department of Health, London), Ras Smit (Health Protection Agency, Birmingham Heartlands Hospital), Peter Tilston (Manchester Royal Infirmary), Steve Kaye (St. Marys Hospital, London), Ian Williams (Mortimer Market Centre, RFUCMS).

Study Governance (2) All participants agree to abide by “Principles of Collaboration” which covers data confidentiality, access to data, publication policy, etc. Steering Committee meets every 6 months All participants are encouraged to submit analysis proposals, which are vetted by Steering Committee

Central database (SQL-Server) Nucleotide sequences + patient identifiers + basic clinical information on request form Virology labs

> 00F6296_16_10_03 Wed Oct 29 10:47:53 GMT+00: bases. CCTCAAATCACTCTTTGGCAGCGACCCCTTGTYWCAATAAAAGTAGGGGG CCAGACAAARGARGCCCTCTTAGACACAGGAGCAGATGATACAGTATTAG ARGAAATAAATTTGCCAGGAAAATGGAAACCAAAAATGATAGGRGGAATT GGAGGTTTTATCAAAGTAAGACAGTATGATCAAATACAGATAGAAATTTG TGGAAAAAAGGCTATAGGTACAGTATTAGTRGGACCTACACCTGTCAACA TAATTGGAAGAAATCTGTtGACTCAGCTTGGATGCACACTAAATTTTCCA aTCAgtCCCATtGAAACTGTACCAGTMAAATTAAAGCCAGGAATGGATGG CCCAAGGGTTAAACAATGGCCATTGACAGAAGAGAAAATaaAAGCATTAA CAGCAATTTGTGAAGAWATGGARAAGGAAGGAAAAATTACAAAAATTGGG CCYGAAAATCCATATAACACTCCAGTATTTGCCATAAAAAAGAAGGACAG TAcTAAGTGGAGAAAATTAGTAGATTTCAGGGAGCTCAATAAAAGAACTC AAGACTTTTGGGAAGTTCAATTAGGAATACCACACCCAGSAGGGTTAAAA AAGAAAAAATCAGTGACAGTACTGGATGTGGGGGATGCATATTTTTCAGT TCCTTTAGATGAAGRCTTCAGGAAATATACTGCATTCACCATACCTAGTA TAAACAATGAAACACCAGGGATTAGATATCAATATAATGTGCTTCCACAG GGATGGAAGGGATCACCAGCAATATTCCAGAGTAGCATGACAAAAATCTT AGagCCCTTTAGGGCACAAAAYCCAGAAATAGTCATYTGTCAATATATGG ATGACTTRTATGTAGSATCAGACTTAGAAATAGGGCAACATAGAGCAAAA ATAGAGGAGTTAAGAgAACATCTRTTGAAGTGGGGAYTTACCACACCAGA CAAGAAACATCAGAAAGAACCCCCATTTCRTTGGATGGGGTATGAACTCC ATCCTGACAARTGGACAGTACAGCCTATACAGCTGCCAGAAAAGGATAGC TGGACTGTCAATGATATACAGAAGTTAGTGGGAAAATTAAACTGGGCAAG TCAGATWTACCARGGGATYAAAGTAAAGCAACTTTGTAAACTCCTTAGRG GRACCAAAGCACTAACAGACATAGTACCACTAACTGAAGAAGCAGAATTA GAATTGGCAGAGAATAGGGARATTCTAAAAGAAACAGTACATgGAGTATA TTATGacCCaTCAAAAGACTTAATAGCTGAAATACAGAAACAGGGGCATG AC

Central database (SQL-Server) Nucleotide sequences + patient identifiers + basic clinical information on request form Virology labs Centre for Virology, UCL Batch file of nucleotide sequences (FASTA) + DB identifier Text files of mutations, subtype, drug susceptibility,...

Central database (SQL-Server) Nucleotide sequences + patient identifiers + basic clinical information on request form Virology labs Clinics Patient identifiers + detailed clinical information (ART history, viral loads,...) Centre for Virology, UCL Batch file of nucleotide sequences (FASTA) + DB identifier Text files of mutations, subtype, drug susceptibility,...

The UK CHIC study Collaboration of some of the largest HIV treatment centres in UK with the following aims: To describe the characteristics of patients with HIV in UK To provide information on exposure to HAART and immunological and virological outcomes To monitor frequency of AIDS events and survival To use information gathered to describe the changing epidemic in the UK Study funded by the Medical Research Council since 2001 Inclusion criteria: Patients aged >16 years seen for care since 1/1/1996; participating centres must have electronic datasets UK CHIC

The UK CHIC Study (2) Centres provide data on all patients seen at their centre since 1 st January 1996 Includes historic data on each patient prior to 1996 if patient was under follow-up at that time Data held in same database as resistance data, although some patients have clinical data and no resistance data and vice versa 21,256 patients in UK CHIC database (in 2005) UK CHIC

Number of tests by calendar year

Number of tests by laboratory (to end 2004)

Scientific outputs (1) 12 Abstracts presented at major HIV conferences, including 8 at International HIV Drug Resistance Workshop 3 HPA surveillance reports on the prevalence and patterns of resistance in ART-naive and ART- experienced patients

Scientific outputs (2) 4 papers in peer-reviewed journals –Long term probability of detection of HIV-1 drug resistance and after starting antiretroviral therapy in routine clinical practice. AIDS 2005, 19: –Estimating HIV-1 drug resistance in antiretroviral-treated individuals in the United Kingdom. Journal of Infectious Diseases 2005, 192: –Time trends in primary resistance to HIV drugs in the United Kingdom: multicentre observational study. BMJ 2005, 331: –Assessment of automated genotyping protocols as tools for surveillance of HIV-1 genetic diversity. AIDS 2006 (in press). 2 papers about to be submitted –Identification of accessory mutations associated with high level resistance in HIV-1 reverse transcriptase. –Predictive factors and clinical outcomes in patients with multi-class drug resistant (MDR) HIV in the UK.

Prevalence of HIV drug resistance in drug-naive patients

Prevalence of resistance to individual drugs

Prevalence of HIV drug resistance in drug-experienced patients

Number of patients with MDR virus (minimum estimates)

Years from start of ART Percent Viral load failure Resistance mutation Percentage of recently-treated patients with resistance or viral load failure

Effect of initial regimen on rate of detection of specific groups of mutations Initial regimen (+ 2 nucleosides) Relative hazard nucleoside mutation mutation to PI or NNRTI mutations to 2/3 drug classes unboosted PI1.59* boosted PI *0.43* abacavir2.24*-1.51 NNRTI1.00 * P<0.01

Examples of other analyses in progress Interaction between subtype and development of PI and NNRTI mutations Predicting virological response from genotypic patterns using Bayesian networks Characterisation of recombinant forms of HIV-1 Clinical utility of HIV resistance testing in ART-naive individuals Frequency and determinants of different TAM pathways

Future direction of work Analyses to date have been fairly broadly based UK CHIC provides opportunity to look at role of individual drugs which most other databases (including Stanford) cannot do In particular can construct complete ART history for each patient

Possible drug-specific analyses Incidence of specific mutations developing on drug combination X Prevalence or numbers of specific mutations in drug experienced patients (e.g. PI experienced patients) Response of patients with mutational pattern X to drug Y

Funding Initially funded by 2-year NHS R&D grant Funded since 2003 by DoH – ends in June DoH unable to continue support due to financial crisis in NHS. Requires ~£110,000 per annum to fund infrastructure of project UK CHIC has recently secured MRC funding until June 2009