Finding approximate palindromes in genomic sequences.

Slides:

Advertisements

Similar presentations

Designing Algorithms Csci 107 Lecture 4. Outline Last time Computing 1+2+…+n Adding 2 n-digit numbers Today: More algorithms Sequential search Variations.

Advertisements

KEY CONCEPT DNA fingerprints identify people at the molecular level.

Lecture 8 Alignment of pairs of sequence Local and global alignment

Bioinformatics Finding signals and motifs in DNA and proteins Expectation Maximization Algorithm MEME The Gibbs sampler Lecture 10.

HIV Project -Matt Hagen. The Problem Are there any DNA sequences in common between HIV and human genomes? HIV-1, complete genome, chimeric clone AF HIV-1,

PSI (position-specific iterated) BLAST The NCBI page described PSI blast as follows: “Position-Specific Iterated BLAST (PSI-BLAST) provides an automated,

A Very Basic Gibbs Sampler for Motif Detection Frances Tong July 28, 2004 Southern California Bioinformatics Summer Institute.

Database searching. Purposes of similarity search Function prediction by homology (in silico annotation) Function prediction by homology (in silico annotation)

Tutorial 5 Motif discovery.

Selection of Optimal DNA Oligos for Gene Expression Arrays Reporter : Wei-Ting Liu Date : Nov

Multiple sequence alignments and motif discovery Tutorial 5.

Using a Genetic Algorithm for Approximate String Matching on Genetic Code Carrie Mantsch December 5, 2003.

Alignment methods June 26, 2007 Learning objectives- Understand how Global alignment program works. Understand how Local alignment program works.

Similar Sequence Similar Function Charles Yan Spring 2006.

Causal-State Splitting Reconstruction Ziba Rostamian CS 590 – Winter 2008.

Computational Biology, Part 2 Sequence Comparison with Dot Matrices Robert F. Murphy Copyright  1996, All rights reserved.

Blast heuristics Morten Nielsen Department of Systems Biology, DTU.

Motif finding: Lecture 1 CS 498 CXZ. From DNA to Protein: In words 1.DNA = nucleotide sequence Alphabet size = 4 (A,C,G,T) 2.DNA  mRNA (single stranded)

A Statistical Method for Finding Transcriptional Factor Binding Sites Authors: Saurabh Sinha and Martin Tompa Presenter: Christopher Schlosberg CS598ss.

Case Study. DNA Deoxyribonucleic acid (DNA) is a nucleic acid that contains the genetic instructions used in the development and functioning of all known.

Pairwise Alignment How do we tell whether two sequences are similar? BIO520 BioinformaticsJim Lund Assigned reading: Ch , Ch 5.1, get what you can.

Basic Introduction of BLAST Jundi Wang School of Computing CSC691 09/08/2013.

Guiding Motif Discovery by Iterative Pattern Refinement Zhiping Wang, Mehmet Dalkilic, Sun Kim School of Informatics, Indiana University.

Some Ideas on Final Project. Feature extraction TGGCCGTACGAGTAACGGACTGGCTGTCTTCTCGT n CCGATACCCCCCACGCGAAACCCTACACATCAAAT p AGCTAACTAGAGTCACTCCTTAGGATAGTGAGCGT.

Computational Biology, Part 3 Sequence Alignment Robert F. Murphy Copyright  1996, All rights reserved.

Good solutions are advantageous Christophe Roos - MediCel ltd Similarity is a tool in understanding the information in a sequence.

Sequence analysis: Macromolecular motif recognition Sylvia Nagl.

A new way of seeing genomes Combining sequence- and signal-based genome analyses Maik Friedel, Thomas Wilhelm, Jürgen Sühnel FLI Introduction: So far,

SPLASH: Structural Pattern Localization Analysis by Sequential Histograms A. Califano, IBM TJ Watson Presented by Tao Tao April 14 th, 2004.

Hugh E. Williams and Justin Zobel IEEE Transactions on knowledge and data engineering Vol. 14, No. 1, January/February 2002 Presented by Jitimon Keinduangjun.

Lecture 6. Pairwise Local Alignment and Database Search Csc 487/687 Computing for bioinformatics.

Motif discovery Tutorial 5. Motif discovery MEME Creates motif PSSM de-novo (unknown motif) MAST Searches for a PSSM in a DB TOMTOM Searches for a PSSM.

BLAST Anders Gorm Pedersen & Rasmus Wernersson. Database searching Using pairwise alignments to search databases for similar sequences Database Query.

CISC667, F05, Lec9, Liao CISC 667 Intro to Bioinformatics (Fall 2005) Sequence Database search Heuristic algorithms –FASTA –BLAST –PSI-BLAST.

CS5263 Bioinformatics Lecture 20 Practical issues in motif finding Final project.

Function preserves sequences Christophe Roos - MediCel ltd Similarity is a tool in understanding the information in a sequence.

PatternHunter II: Highly Sensitive and Fast Homology Search Bioinformatics and Computational Molecular Biology (Fall 2005): Representation R 林語君.

Whole Genome Repeat Analysis Package A Preliminary Analysis of the Caenorhabditis elegans Genome Paul Poole.

Book: Algorithms on strings, trees and sequences by Dan Gusfield Presented by: Amir Anter and Vladimir Zoubritsky.

Watson & Crick Discovered the basic shape of DNA

Motif discovery and Protein Databases Tutorial 5.

Basic Local Alignment Search Tool BLAST Why Use BLAST?

Biocomputation: Comparative Genomics Tanya Talkar Lolly Kruse Colleen O’Rourke.

Human Genomics. Writing in RED indicates the SQA outcomes. Writing in BLACK explains these outcomes in depth.

1 Motifs for Unknown Sites Vasileios Hatzivassiloglou University of Texas at Dallas.

BLAST, which stands for basic local alignment search tool, is a heuristic algorithm that is used to find similar sequences of amino acids or nucleotides.

Sequence Alignment.

Doug Raiford Phage class: introduction to sequence databases.

Blast 2.0 Details The Filter Option: –process of hiding regions of (nucleic acid or amino acid) sequence having characteristics.

Sequence Search Abhishek Niroula Department of Experimental Medical Science Lund University

Step 3: Tools Database Searching

Tutorial 8 Gene expression analysis 1. How to interpret an expression matrix Expression data DBs - GEO Clustering –Hierarchical clustering –K-means clustering.

Maik Friedel, Thomas Wilhelm, Jürgen Sühnel FLI-Jena, Germany Introduction: During the last 10 years, a large number of complete.

MGM workshop. 19 Oct 2010 Some frequently-used Bioinformatics Tools Konstantinos Mavrommatis Prokaryotic Superprogram.

HW4: sites that look like transcription start sites Nucleotide histogram Background frequency Count matrix for translation start sites (-10 to 10) Frequency.

Neural Networks And Its Applications By Dr. Surya Chitra.

The Genome Genome Browser Training Materials developed by: Warren C. Lathe, Ph.D. and Mary Mangan, Ph.D. Part 2.

DNA. DNA fingerprinting, DNA profiling, DNA typing  All terms applied to the discovery by Alec Jeffreys and colleagues at Leicester University, England.

Assembly S.O.P. Overlap Layout Consensus. Reference Assembly 1.Align reads to a reference sequence 2.??? 3.PROFIT!!!!!

HW7: Evolutionarily conserved segments ENCODE region 009 (beta-globin locus) Multiple alignment of human, dog, and mouse 2 states: neutral (fast-evolving),

Find the replication origins in Genomics. Herpesvirus Members of the family herpesviridae are found in a wide range of host systems.

Genetic Algorithm. Outline Motivation Genetic algorithms An illustrative example Hypothesis space search.

Bioinformatics Computing 1 CMP 807 – Day 4 Kevin Galens.

Lesson: Sequence processing

Introduction to Programming

Introduction to Biotechnology

A Very Basic Gibbs Sampler for Motif Detection

Notes 13.1 DNA.

Basic Local Alignment Search Tool

Sequence alignment, E-value & Extreme value distribution

Presentation transcript:

Finding approximate palindromes in genomic sequences.

Project goals Implementation of an algorithm for finding approximate palindromes in genomic sequences. Usage of the algorithm for purposes of creating “palindrome fingerprints”. Develop methods for testing the significance of specific approximate palindromes.

Background Palindrome - A double strand DNA locus whose 5'-to-3' sequence is identical on each DNA strand. The sequence is the same when one strand is read left to right and the other strand is read right to the left. Alternatively looking on one strand of the DNA the definition for palindrome is: A region of sequence, that when it’s been read left to right it is complementary to the sequence that been read right to left (A match T, and C match G).

Approximate Palindrome contain a certain number of mismatches and allow gap. “palindrome fingerprints” - Each DNA sequence has it’s unique number, sizes of palindromes, and location in sequence.

Important biological roles : 1) gene annotation. 2) transcription-binding sites.

Statistical model n – length of string. l – length of palindrome (not including the gap). G – maximum length of gap. y – max number of mismatches allowed. x- number of mismatches p- number of palindromes in a string of length n

Calculating the probability to a find a specific palindrome of length l, k times in a string of length n.

Application Implemented in C Input: 1) Sequence, genome of different organisms, text file in a FASTA format. 2) Length of palindrome (one side). 3) Maximum gap between repeated regions. 4) Number of mismatches allowed. Output - all the palindromes within a specified length range and also a range of mismatch.

The Algorithm: > Search for the palindrome within a “window”, in the size of MaxSize. > Each iteration incrementing the size of palindrome, until MaxSize is reached. > Shift left of the window.

Algorithm Testing “Plant” an approximate palindrome in different genomes and compare the results with our expectations. Compare our formula expectation with the result of several random sequences

Practical usage of the Algorithm Compare the palindrome profile of different organisms and evaluate the results: Genome from different bacteria. Same gene, for example: hemoglobin, insulin in different mammals. Gene families, for example: Histones, Immunoglobins.

The End.