Gil Ast Dep. of Human Molecular Genetics and Biochemistry Room 1009, 10 th floor Tel:
Sylabus The Cell by B. Alberts Essential Cell Biology by Alberts
Genetics Science of genes Molecular Biology Gene expression
Embryonic stem cells Day 1 Day 2-3Day 4Day 5 Day 6-9 Day 14
nucleus Gene - encodes for protein Each cell in our body contains the same genetic information (DNA)
The pathway of gene expression
H deoxy A nucleotide
RNADNA The sugar of RNA and DNA
O The base bind position 1
The bases
single strand DNA ssDNA
1)5’-to-3’ Phosphodiester bond 2) direction 3) 5’ end 3’end 4) upstream and downstream
How to describe DNA GAACCTGAGACCTACTGGTCCG
Base-paring
Base pair = bp Double strand DNA = dsDNA dsDNA Anti-paralel
dsDNA 1.Anti-parallel 2.Complementary strand 3. ladder 4. Each basepair is called 1bp
A:T and G:C =
Gene – a DNA region that is transcribed to RNA, and the RNA with a biological function Gene 3
Intron – a region in the DNA that is transcribed but removed from the mRNA precursor and is not part of the mature mRNA Exons – part of the mature mRNA Introns are found only in eukaryotes
2.91 billion base pairs 24,000 protein coding genes (~32,000 non-coding genes) 1.5% exons (127 nucleotides) 24% introns (~3,000 nucleotides) 75% intergenic (no genes) Average size of a gene is 27,894 bases Contains an average of 8.8 exons Titin contains 234 exons. Human genome
We humans are 99.9% identical at the DNA sequence level There are still ~3 million nucleotide differences among us called SNPs (60,000 within the exons)---that presumably account for differences in disease susceptibility, drug responses, etc. Polymorphic variation between and within populations Implications for concepts of “race,” “individuality”
24,000
MOLECULAR BIOLOGY OF THE DISEASE Duchenne Muscular Dystrophy is one of more than twenty different types of muscular dystrophy. The Duchenne type affects only boys and is known to result from a defect in a single important protein in muscle fibers called Dystrophin. The muscle fiber will break down if the Dystrophin is missing and is unable to function properly. As a result, the reduction in the number of good muscle fibers and the whole muscle becomes weak. Duchenne Muscular Dystrophy
DNA, Chromosome Centromere, telomere, replication origin Nucleosome, Chromatin, Histone: H1, H2A, H2B, H3, H4 Histone octamer, DNA packaging DNA binding proteins, Histone modifications Summary
Histone proteins
HDAC HAT HDAC activity
מבנה הנוקלאוזום סיכת ביטחון
H2AH2B H3H4
Covalent Modification of core histone tails Acetylation of lysines (K) Mythylation of lysines Phosphorylation of serines (S) Histone acetyl transferase (HAT) Histone deacetylase (HDAC) Acetylation Mythylation epigenetics
4 Penicillin mold 46Human 32Yeast42Macaque 40Mouse 38Cat 48Potato26Frog 20Algae16Planaria 20Corn8Fruit fly Species Total number of chromosomes/somatic (body) cell Dog 78 There is no connection between the number of chromosomes and the genome size, gene content, or any other feature of genomes. It is and essentially independent characteristic.
Cockayne syndrome group B (CSB) cells that fail to express CSB protein which causes profound neurological and developmental defects Blue – DNA White - gene
Chromosomal fragile sites are loci that are especially prone to forming gaps or breaks on metaphase chromosomes when cells are cultured under conditions that inhibit DNA replication or repair. The relationship of "rare" folate sensitive fragile sites with (CCG)n expansion and, in some cases, genetic disease is well established.
Fragile X syndrome What is Fragile X syndrome? Fragile X syndrome is the most common inherited cause of mental impairment, affecting approximately 1 in 2,000 males and 1 in 4,000 females worldwide. Cytogenetic analysis of metaphase spreads demonstrates the presence of the fragile site in less than 60% of cells in most affected individuals.). In 1991, the fragile X gene (FMR1) was characterized and found to contain a tandem repeated trinucleotide sequence (CGG) near its 5' end. The mutation responsible for fragile X syndrome involves expansion of this repeat segment. The number of CGG repeats in the FMR1 genes of the normal population varies from six to approximately 50. There are two main categories of mutation, premutations of approximately 50 to 200 repeats and full mutations of more than approximately 200 repeats. There is no clear boundary between the upper limit of normal and the lower limit of the premutation range. For this reason, alleles with approximately copies of the repeat are said to be in the "grey zone." Some alleles in this size range are unstable and expand from generation to generation, while others are stably inherited. A premutation is susceptible to expansion after passage through a female meiosis. The larger the size of a woman's premutation, the more the risk of expansion to a full mutation in her offspring..
In man 10 4 to 10 5 sites a replication rate of 2 kb/minute
Origins of replication In E. coli only one site OriC In man 10 4 to 10 5 sites The direction of replication is bi-directional OriC
If this shoelace were a chromosome, then these two protective tips would be its The problem – DNA ends!
CHROMOSOME TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG AATCCCAATCCC 5’ 3’ TELOMERE The solution: adding repetitive sequences to the ends
T n A m G o type of minisatellite repeat TTAGGG – human TTTAGGG – Arabidopsis TTGGGG - Tetrahymena TTAGG – Bombyx TTTTAGGG – Chlamydomonas TTTTGGGG – Oxytricha TTAGGC - Ascaris (TG) Saccharomyces cereviceae
Telomere senescent cells have shorter telomeres length differs between species in humans 8-14kb long telomere replication occurs late in the cell cycle Telomeres are shortened by 40-to-200 bases between one cell division to the other.
Provide protection from enzymatic degradation and maintain chromosome stability Organization of the cellular nucleus by serving as attaching points to the nuclear matrix Allows end of linear DNA to be replicated completely Functions
End-to-end fusion
Telomerase 1.Telomerase binds to the telomer and the internal RNA component aligns with the existing telomer repeats. 2.Telomerase synthesizes new repeats using its own RNA component as a template 3.Telomerase repositions itself on the chromosome and the RNA template hybridizes with the DNA once more.
Telomerase is not active in most somatic cells
Cancer cells have telomerase
Dolly is aging too rapidly?….or was born 6 years old (telomers were 80% of normal sheep) Dolly has developed pre-mature arthritis
Werner Patient TeenagerAge 48