Lecture 22 Cancer Genetics II: Inherited Susceptibility to Cancer Stephen B. Gruber, MD, PhD November 19, 2002.

Slides:



Advertisements
Similar presentations
Colon Cancer The life time risk of developing Colon Cancer in the United States in one in sixteen. This means 144,000 new cases a year accounting for.
Advertisements

This short questionnaire will help to determine whether there may be a gene in your family connected to an increased risk of the development of bowel.
Hereditary GI Cancer Syndromes: Keys to identify high risk patients
? BrCA at 44 BrCA at 51 BrCA at 58 Tom Example: Breast Cancer Sporadic Family clusters Hereditary 5%–10% 15%  20% An inherited predisposition.
Universal Screening of Lynch Syndrome Heather Hampel, MS, CGC Clinical Associate Professor, Division of Human Genetics.
Introduction to Cancer Genetics
Gene 210 Cancer Genomics April 29, Key events in investigating the cancer genome M R Stratton Science 2011;331:
Lynch Syndrome and Colorectal Cancer Steven G. Proshan, M.D. Annapolis Colon and Rectal Surgeons Anne Arundel Medical Center November 8,
Screening for Colorectal Cancer Cancer Symposium: Measuring the Benefits of Screening and Treatment October 2007.
Risk Assessment for HNPCC
A few thoughts on cancer and cancer family syndromes Pamela McGrann, MD. Department of Medical Genetics.
COLORECTAL BLEEDING: a multidisciplinary approach Torino, 31 marzo-1 aprile 2006 GENETIC EVALUATION Schena M, Angelini F, Bertetto O. Department of Medical.
Hereditary Colon Cancer ACP, October 2013 Steve Lanspa MD, FACP.
Mechanisms and Epidemiology of Colon Cancer
Genetics and Ovarian Cancer Jeanne M. Schilder, M.D. Associate Professor, Gynecologic Oncology Indiana University Medical Center September 19, 2012.
Genetics and Primary Care
Hereditary Colorectal Cancer: An Overview Felice Schnoll-Sussman,MD Jay Monahan Center for Gastrointestinal Health New York Hospital/ Weill Cornell Medical.
About these slides SPEC – Short Presentation in Emerging Concepts
Familial Colorectal Cancers Francis M. Giardiello, M.D. The Johns Hopkins University.
Genetics of Colorectal Cancer
Comprehensive IHC Screening for Lynch Syndrome: What You Need to Know Andrea Lewis, MS, CGC January 14, 2010.
Hereditary tumours to be aware of Gerd JACOMEN Dept. of Pathology.
Kalyani Maganti, M.D. ASCO Chromosomes, DNA, and Genes Cell Nucleus Chromosomes Gene Protein.
Morning Report May 20, 2009 Bridger Clarke  Born in Lawrence, Massachusetts, on 4 January  Dropped out of high school at the age of fourteen.
Type Of Cancer:Location: CarcinomaEpithelial Cells SarcomaConnective Tissue LeukemiaCirculatory / Lymphatic.
Introduction to Cancer Genetics and Genomics Apostolos Psychogios, MD, FACMG Associate Professor of Pediatrics LeeAnne Brown Chair of Clinical Excellence.
Colorectal Cancer Update Jonathan A. Laryea, MD FACS FASCRS FWACS Division of Colon & Rectal Surgery Department of Surgery University of Arkansas for Medical.
Gene 210 Cancer Genomics May 5, Key events in investigating the cancer genome M R Stratton Science 2011;331:
HENRY T. LYNCH, MD JANE F. LYNCH, BSN Creighton University
MLH 1 and Hereditary Nonpolyposis Colorectal Cancer
Cancer Genetics for Primary Care Sara Levene Registered Genetic Counsellor.
Genetics & Colorectal Cancer
Cancer Genetics Genetic Disorder. What are cancer genetics? Many cancer-predisposing traits are inherited in an autosomal dominant fashion, that is, the.
Genetics of Colorectal Cancer
Genetics and Ovarian Cancer June 16, 2015 Ovarian Cancer Alliance of Oregon and SW Washington Becky Clark, MS, CGC Genetic Counselor.
Beyond the Scope: Extra Colonic Cancer Risks in HNPCC and Screening VHL Family Alliance Joy Larsen Haidle, MS, CGC Genetic Counselor Humphrey Cancer Clinics.
An Overview of Clinical Cancer Genetics
DNA Repair and Cancer. Genome Instability Science, 26 July 2002, p. 544.
Malignant disease of colon and rectum Seyed vahid hosseini Professor of surgery Professor of surgery Department of surgery Colo-rectal ward.
Colon Cancer can be prevented Early detection improves prognosis
Colorectal carcinoma Dr.Mohammadzadeh.
Angelina Jolie The White Coat Wonder. Rational  The purpose of our research is to enrich the Premed-A community with the knowledge of other cancers caused.
 FAP - familial adenomatous polyposis  germline mutations in the APC gene (“gatekeeper”)  HNPCC - hereditary nonpolyposis colon cancer (a.k.a. Lynch.
New Era of Genetic Testing in Colon Cancer
Familial Cancer. General Principles Mutations inherited through germ cells contribute to a minority of tumours Two hits usually needed germline/somatic.
Approach to a Mass of Unknown Significance Location Kinetics Systemic Manifestations.
Tumour Analysis-Lynch Syndrome Dr Alan Donaldson Consultant in Clinical Genetics Bristol.
Familial Risk and Surveillance of Colon and Rectum Malcolm Dunlop Academic Coloproctology & Colon Cancer Genetics Group University of Edinburgh & Western.
Summer Dewdney, MD Rush University Medical Center.
סרטן מעי גס אבחון מוקדם מניעה טיפול מונע ד"ר הוברט אילה מנהלת המרכז לגידולים במערכת העיכול מכון שרת הדסה עין כרם.
What are Microsatellites? D2S123 TAGGCCACACACACACACACA Unique Primer Mono, di, tri, tetra nucleotide repeats HNPCC - Expansion/contraction of nl repeats.
Bonny Blackard Biology 169 April 4, 2006
MLH1: Hereditary non- polyposis colon cancer (HNPCC) By: Alison Edge.
Identifying and Managing Hereditary Cancer Syndromes © 2005 Myriad Genetic Laboratories, Inc. Monica Trout, MS Genetic Counselor / Regional Medical Specialist.
Do you have 3 or more affected relatives? (2 or less)
Colorectal cancer Screening and Prevention Dr malek Alhamidi
Robert E. Schoen, MD MPH Associate Professor of Medicine and Epidemiology Division of Gastroenterology University of Pittsburgh Hereditary Colorectal Cancer:
Lynch Syndrome or Hereditary Non-Polyposis Colorectal Cancer (HNPCC)
MLH1 and HNPCC March 29, 2005 Tammy Jernigan
HEREDITARY GASTROINTESTINAL CANCER SYNDROMES
Genetics 202: Clinical Cancer Genetics
EPIDEMIOLOGY.
Genetic Findings in Familial Gastrointestinal Cancers
What are Microsatellites?
Hereditary Colon Cancer Syndromes
Hereditary Colorectal Cancer: From Genetic Testing to Prevention
The Role of MSH2 in Hereditary Non-Polyposis Colon Cancer
Lynch syndrome (LS) Hereditary Non-polyposis Colorectal Cancer (HNPCC)
Noralane M Lindor  Clinical Gastroenterology and Hepatology 
Short Presentations in Emerging Concepts (SPEC)
Presentation transcript:

Lecture 22 Cancer Genetics II: Inherited Susceptibility to Cancer Stephen B. Gruber, MD, PhD November 19, 2002

Cancer Genetics: II Summary Inherited susceptibility to cancer due to germline mutations Causes of inherited susceptibility to colorectal cancer Familial Adenomatous Polyposis Hereditary Non-Polyposis Colorectal Cancer

Causes of Hereditary Susceptibility to CRC Adapted from Burt RW et al. Prevention and Early Detection of CRC, 1996 Sporadic (65 %– 85%) Familial (10 %– 30%) Hereditary nonpolyposis colorectal cancer (HNPCC) (5%) Familial adenomatous polyposis (FAP) (1%) Rare CRC syndromes (<0.1%)

Multi-Step Carcinogenesis NormalepitheliumHyper-proliferativeepitheliumEarlyadenomaLateadenomaCarcinomaMetastasis Loss of APCActivation of K-ras Loss of 18q TP53Otheralterations Adapted from Fearon ER. Cell 61:759, 1990 Inter-mediateadenoma ASCO

Risk of Colorectal Cancer (CRC) General population Personal history of colorectal neoplasia Inflammatory bowel disease HNPCC mutation FAP 6% 15%–20% 15%–40% 70%–80% >95% Lifetime risk (%)

Clinical Features of FAP Estimated penetrance for adenomas >90% Risk of extracolonic tumors (upper GI, desmoid, osteoma, thyroid, brain, other) CHRPE may be present Untreated polyposis leads to 100% risk of cancer ASCO

Some FAP Manifestations Correlate With Specific APC Gene Regions Attenuated FAP Classic FAP CHRPE '3'

Attenuated FAP ASCO Later onset (CRC ~age 50)Later onset (CRC ~age 50) Fewer colonic adenomasFewer colonic adenomas Not associated with CHRPENot associated with CHRPE UGI lesionsUGI lesions Associated with mutations at 5' and 3' ends of APC geneAssociated with mutations at 5' and 3' ends of APC gene

Clinical Features of HNPCC Early but variable age at CRC diagnosis (~45 years) Tumor site in proximal colon predominates Extracolonic cancers: endometrium, ovary, stomach, urinary tract, small bowel, bile ducts, sebaceous skin tumors

Amsterdam Criteria l 3 or more relatives with verified CRC in family - One case a first-degree relative of the other two - One case a first-degree relative of the other two l 2 or more generations l 1 CRC by age 50 l FAP excluded Vasen HFA et al. Dis Colon Rect 34:424, 1991 Failure to meet these criteria does not exclude HNPCC

Genetic Features of HNPCC Autosomal dominant inheritance Penetrance ~80% Genes belong to DNA mismatch repair (MMR) family Genetic heterogeneity (MLH1, MSH2, MSH6, PMS1, PMS2)

Genetic Heterogeneity in HNPCC HNPCC is associated with germline mutations in any one of at least five genes Chr 2 Chr 3 Chr 7 MSH2 PMS1 MLH1 PMS2 MSH6

Contribution of Gene Mutations to HNPCC Families MSH2 ~30% MLH1~30% PMS1 (rare) PMS2 (rare) MSH6 (rare) Unknown ~30% SporadicFamilial HNPCC FAP Rare CRC syndromes Liu B et al. Nat Med 2:169, 1996

Cancer Risks in HNPCC Aarnio M et al. Int J Cancer 64:430, 1995 % with cancer Age (years) Colorectal 78% Endometrial 43% Stomach 19% Biliary tract 18% Urinary tract 10% Ovarian 9% ASCO

HNPCC Results From Failure of Mismatch Repair (MMR) Genes Base pair mismatch Normal DNA repair Defective DNA repair (MMR+) T CTA C A G C T G T C G A C A G C T G T CTA C A G A T G T C T A C

Structure of Mismatch Repair Obmolova G, Nature 407;703, 2000 Lamers et al, Nature 407;711, 2000

Mismatch Repair Failure Leads to Microsatellite Instability (MSI) Normal Microsatellite instability Addition of nucleotide repeats

NEJM 342:71, 2000 Microsatellite Instability (MSI) 10%–15% of sporadic tumors have MSI10%–15% of sporadic tumors have MSI 95% of HNPCC tumors have MSI at multiple loci95% of HNPCC tumors have MSI at multiple loci

Surveillance Options for Carriers of HNPCC-Associated Mutations Cancer Genetics Studies Consortium Task Force Recommendations Modified from Burke W et al. JAMA 277:915, 1997 InterventionColonoscopy Transvaginal ultrasound Transvaginal ultrasound Endometrial aspirate Endometrial aspirateRecommendation Begin at age 20–25, repeat every 1–2 years Annually, starting at age 25–35 Malignancy Colorectal cancer Endometrial cancer

Surveillance Reduces Risk of Colorectal Cancer in HNPCC Families Jarvinen HJ et al. Gastro 108:1405, 1995 % of subjects with CRC % 11.9% 0369 Years of follow-up Surveillance No surveillance 0 ASCO

Surveillance Improves HNPCC Survival Jarvinen H et al Gastroenterology 118;829, 2000 Years of follow-up Survival 65% reduction in mortality p = 0.05 Surveillance No surveillance

Cancer Genetics: II Summary Inherited susceptibility to cancer due to germline mutations Familial Adenomatous Polyposis Hereditary Non-Polyposis Colorectal Cancer –Amsterdam criteria Surveillance reduces the risk of cancer Genetic counseling / testing plays an important role in the management of families with inherited susceptibility to cancer

Special thanks to David Barrett Please check out his latest CD, “It’s a long, long story” or in concert at the Greenwood Café Acoustic Series December 6, 7:30pm