Nucleic Acids Genetic Material
Nucleic Acids are macromolecules Nucleic Acids are the source of genetic material for all living things Nucleic Acids are the source of genetic material for all living things There are two main types: DNARNA
A Nucleotide is the Monomer that will make up Nucleic Acids It is made up of three parts One part is a 5-carbon sugar (pentose) One part is a 5-carbon sugar (pentose) This sugar is also called ribose (in RNA) Or Deoxy-ribose (In DNA) – Deoxyribose nucleic acid
What is the difference between Ribose and Deoxy ribose?
Second part of a Nucleotide Attached to the sugar is a Nitrogen- containing based Bases are made up of a ring-like carbon, hydrogen and Nitrogen structure There are four different bases: Adenine, Cytosine, Guanine, Thymine
Uracil Replaces Thymine in RNA
3 dimensional view
The Third Component of a Nucleotide is a Phosphate Group
Put it all together now…
Structurally it is important to Note: In HUMANs and most animals, DNA is always double stranded RNA is always Single stranded There are three kinds of RNA…which we will talk about later. There are three kinds of RNA…which we will talk about later.
The Double Helix In 1953 James Watson and Francis Crick proposed a model for DNA that is still accepted today
Two Experiments This is an x ray of crystalized DNA taken by Rosalind Franklin - The Dark Lady of DNA
Rosalind the Chrystalographer
It was Rosalind’s image that led Watson and Crick to the double helix model of DNA DNA is made up of two long chains. Each with a sugar phosphate backbone BUT: The two back-bone’s run in opposite direction!
Watson and Crick determined that the four bases pair up very specifically Discovered in 1953, won Nobel Prize in 1962
Watson and Crick used discoveries of other researchers to build their model Experiments done by Rosalind Franklin and Maurice Wilkins suggested to Watson and Crick, that DNA molecules had a double helix structure
Watson and Crick came up with the idea of Base Pairing Bases pair up together in the double helix Cytosine only pairs with Guanine and vice versa Cytosine only pairs with Guanine and vice versa Thymine only pairs with Adenine and vice versa Thymine only pairs with Adenine and vice versa
The Genetic Code DNA forms the genes – units of genetic information that pass from parent to offspring The human genome is ~ 3 billion base pairs long and has been completely mapped
DNA taken with a Scanning Tunneling Microscope
A single DNA molecule - this is a chromosome
Unravelled vs condensed
DNA use as evidence Like a fingerprint DNA is unique to an individual Look your right or left The person sitting next to you is 99.9% similar to you
DNA use Mostly used to exonerate innocent suspects Blood Blood Hair Hair Saliva Saliva Semen Semen Vaginal fluid Vaginal fluid Gastric juices Gastric juices Feces Feces Urine Urine sweat sweat
DNA analysis can be used if a suspect leaves behind a sample of themselves; OR if the victim’s DNA is found on something that is linked to the suspect Rape Murder - especially violent murder BatteryTheft Agricultural tracing Agricultural tracing
Pros and Cons Pros DNA can be found almost anywhere, skin cells and hair fall off and we can’t even see it most of the time! DNA can be found almost anywhere, skin cells and hair fall off and we can’t even see it most of the time! Tests are so sensitive that only 50µm are needed Tests are so sensitive that only 50µm are needed Cons Cons Not 100% Not 100% Time and Labor intensive Time and Labor intensive A single rape kit takes 5 1/2 hours to complete
Cases Snowball the cat 2001 P.E. Island P.E. Island Woman murdered Woman murdered Snowy white cat hair found on jacket near the crime scene Snowy white cat hair found on jacket near the crime scene DNA analysis showed that it matched the cat owned by the woman’s estranged husband DNA analysis showed that it matched the cat owned by the woman’s estranged husband
Palo Verde Tree Woman murdered Suspect’s car covered in seed pods DNA analysis showed that the pods in his car matched the tree at the murder scene They could place the suspect at the crime scene! They could place the suspect at the crime scene!
Mass fatalities - September 11th Over 20,000 pieces of human remains were sent to medical examiners Of the 2792 known to have died were identified Most samples were too charred In 2005 Bode Technologies developed a new method of Identification -requires less sample In 2005 Bode Technologies developed a new method of Identification -requires less sample
Duke Lacrosse Players 3 lacrosse players accused of rape DNA analysis showed that it did NOT match the players in question or any other member of the team Evidence was held by prosecution for 6 months Players were kicked off the team - held under suspicion for 400 days They have been found Not Guilty
How can Forensic Scientists use DNA? In the human genome there are certain places where there are known sequences We can use these parts as markers and we can use specific enzymes to cut the DNA strand at this spot
Restriction Enzymes are used to cut DNA These enzymes are produced by certain types of bacteria What these enzymes do is recognize specific patterns in a DNA sequence and cut the DNA like a pair of scissors
Viral Infection
Bacteria have evolved a defense Restriction enzymes can cut DNA of foreign intruders
Restriction Enzymes Cut DNA at a palindrome What is a palindrome ? A sequence that reads the same backwards as forwards…Do you see the palindrome in the below sequence? GTAGAATTCATTCACGCACATCTTAAGTAATGCGT
Now do you see it? GTA G-AATTC ATTCACGCA CAT C-TTAA-G TAATGCGT This is the region where a restriction enzyme would recognize and CUT or CLEAVE the DNA Eco RI Eco RI
Restriction Fragment Length Polymorphism This is the ability to cut DNA at a specific code using Restriction Enzymes These regions that scientists can cut, will result in varying segment lengths for different people,
Gel Electrophoresis
A molecule of DNA has an extremely negative charge So we can use this to run an electric charge through an electophoresis cell--- see below
As the electrical charge occurs we have a current of positive ions flowing through our gel. The DNA will migrate down the gel toward the positive end of the cell
The negative DNA is attracted to the Positive end of the electrophoresis cell
Do you see the different band patterns? They are all different size DNA pieces
After the DNA has been chopped up by enzymes, the shorter pieces will move down the gel faster than the longer pieces
Is it possible that two different people would have the same lengths strands after the DNA samples have been cut? Yes!!! - So this method would be a good way to eliminate suspects. This method alone could not incriminate a suspect
In a criminal case where DNA evidence is available an electrophoresis would be one of the first techniques used In actuality Forensic scientists don’t use electroporesis anymore…but it was one of the original DNA fingerprinting techniques Why do you think this is?
Because we the process is relatively inexpensive and quick to do, and suspects whose bands were very different could be immediately eliminated
Suspects who had similar banding patterns would have to be further analyzed …Their DNA would probably be sequenced to determine if the sequences matched
DNA can be sequenced using PCR The Polymerase Chain Reaction