Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics August 15, 2010

Collagen VI myopathies  Bethlem Myopathy  Proximal muscle weakness and atrophy  Dynamic contractures in distal joints (fingers, wrists, elbows, and ankles)  Onset in first or second decade  Slowly progressive in adult years  2/3 of patients >50 years-old require assistance for ambulation  Ullrich Congenital Muscular Dystrophy  Severe weakness/hypotonia in early infancy  Proximal joint contractures  Distal joint hyperlaxity  Collagen VI myopathies likely represent spectrum of phenotypes defined by type and distribution of contractures

Three genes of Collagen VI C  1(VI)  2(VI)  3(VI) N10N9N8N7N6N5N4N3N2 N1 C1 C2TH C1C2THC4C3C5 C C von Willebrand factor A domain Alternatively spliced vWF A Triple-helix Lysine/proline repeats Fibronectin type III motif Kunitz protease inhibitor motif

COL6A base pairs  gctctcactctggctgggagcagaaggcagcctcggtctctgggcggcggcggcggccca ctctgccctggccgcgctgtgtggtgaccgcaggccccagacatgagggcggcccgtgct ctgctgcccctgctgctgcaggcctgctggacagccgcgcaggatgagccggagaccccg agggccgtggccttccaggactgccccgtggacctgttctttgtgctggacacctctgag agcgtggccctgaggctgaagccctacggggccctcgtggacaaagtcaagtccttcacc aagcgcttcatcgacaacctgagggacaggtactaccgctgtgaccgaaacctggtgtgg aacgcaggcgcgctgcactacagtgacgaggtggagatcatccaaggcctcacgcgcatg cctggcggccgcgacgcactcaaaagcagcgtggacgcggtcaagtactttgggaagggc acctacaccgactgcgctatcaagaaggggctggagcagctcctcgtggggggctcccac ctgaaggagaataagtacctgattgtggtgaccgacgggcaccccctggagggctacaag gaaccctgtggggggctggaggatgctgtgaacgaggccaagcacctgggcgtcaaagtc ttctcggtggccatcacacccgaccacctggagccgcgtctgagcatcatcgccacggac cacacgtaccggcgcaacttcacggcggctgactggggccagagccgcgacgcagaggag gccatcagccagaccatcgacaccatcgtggacatgatcaaaaataacgtggagcaagtg tgctgctccttcgaatgccagcctgcaagaggacctccggggctccggggcgaccccggc tttgagggagaacgaggcaagccggggctcccaggagagaagggagaagccggagatcct ggaagacccggggacctcggacctgttgggtaccagggaatgaagggagaaaaagggagc cgtggggagaagggctccaggggacccaagggctacaagggagagaagggcaagcgtggc atcgacggggtggacggcgtgaagggggagatggggtacccaggcctgccaggctgcaag ggctcgcccgggtttgacggcattcaaggaccccctggccccaagggagaccccggtgcc tttggactgaaaggagaaaagggcgagcctggagctgacggggaggcggggagaccaggg agctcgggaccatctggagacgagggccagccgggagagcctgggccccccggagagaaa ggagaggcgggcgacgaggggaacccaggacctgacggtgcccccggggagcggggtggc cctggagagagaggaccacgggggaccccaggcacgcggggaccaagaggagaccctggt gaagctggcccgcagggtgatcagggaagagaaggccccgttggtgtccctggagacccg ggcgaggctggccctatcggacctaaaggctaccgaggcgatgagggtcccccagggtcc gagggtgccagaggagccccaggacctgccggaccccctggagacccggggctgatgggt gaaaggggagaagacggccccgctggaaatggcaccgagggcttccccggcttccccggg tatccgggcaacaggggcgctcccgggataaacggcacgaagggctaccccggcctcaag ggggacgagggagaagccggggaccccggagacgataacaacgacattgcaccccgagga gtcaaaggagcaaaggggtaccggggtcccgagggcccccagggacccccaggacaccaa ggaccgcctgggccggacgaatgcgagattttggacatcatcatgaaaatgtgctcttgc tgtgaatgcaagtgcggccccatcgacctcctgttcgtgctggacagctcagagagcatt ggcctgcagaacttcgagattgccaaggacttcgtcgtcaaggtcatcgaccggctgagc cgggacgagctggtcaagttcgagccagggcagtcgtacgcgggtgtggtgcagtacagc cacagccagatgcaggagcacgtgagcctgcgcagccccagcatccggaacgtgcaggag ctcaaggaagccatcaagagcctgcagtggatggcgggcggcaccttcacgggggaggcc ctgcagtacacgcgggaccagctgctgccgcccagcccgaacaaccgcatcgccctggtc atcactgacgggcgctcagacactcagagggacaccacaccgctcaacgtgctctgcagc cccggcatccaggtggtctccgtgggcatcaaagacgtgtttgacttcatcccaggctca gaccagctcaatgtcatttcttgccaaggcctggcaccatcccagggccggcccggcctc tcgctggtcaaggagaactatgcagagctgctggaggatgccttcctgaagaatgtcacc gcccagatctgcatagacaagaagtgtccagattacacctgccccatcacgttctcctcc ccggctgacatcaccatcctgctggacggctccgccagcgtgggcagccacaactttgac accaccaagcgcttcgccaagcgcctggccgagcgcttcctcacagcgggcaggacggac cccgcccacgacgtgcgggtggcggtggtgcagtacagcggcacgggccagcagcgccca gagcgggcgtcgctgcagttcctgcagaactacacggccctggccagtgccgtcgatgcc atggactttatcaacgacgccaccgacgtcaacgatgccctgggctatgtgacccgcttc taccgcgaggcctcgtccggcgctgccaagaagaggctgctgctcttctcagatggcaac tcgcagggcgccacgcccgctgccatcgagaaggccgtgcaggaagcccagcgggcaggc atcgagatcttcgtggtggtcgtgggccgccaggtgaatgagccccacatccgcgtcctg gtcaccggcaagacggccgagtacgacgtggcctacggcgagagccacctgttccgtgtc cccagctaccaggccctgctccgcggtgtcttccaccagacagtctccaggaaggtggcg ctgggctagcccaccctgcacgccggcaccaaaccctgtcctcccacccctccccactca tcactaaacagagtaaaatgtgatgcgaattttcccgaccaacctgattcgctagatttt ttttaaggaaaagcttggaaagccaggacacaacgctgctgcctgctttgtgcagggtcc tccggggctcagccctgagttggcatcacctgcgcagggccctctggggctcagccctga gctagtgtcacctgcacagggccctctgaggctcagccctgagctggcgtcacctgtgca gggccctctggggctcagccctgagctggcctcacctgggttccccaccccgggctctcc tgccctgccctcctgcccgccctccctcctgcctgcgcagctccttccctaggcacctct gtgctgcatcccaccagcctgagcaagacgccctctcggggcctgtgccgcactagcctc cctctcctctgtccccatagctggtttttcccaccaatcctcacctaacagttactttac aattaaactcaaagcaagctcttctcctcagcttggggcagccattggcctctgtctcgt tttgggaaaccaaggtcaggaggccgttgcagacataaatctcggcgactcggccccgtc tcctgagggtcctgctggtgaccggcctggaccttggccctacagccctggaggccgctg ctgaccagcactgaccccgacctcagagagtactcgcaggggcgctggctgcactcaaga ccctcgagattaacggtgctaaccccgtctgctcctccctcccgcagagactggggcctg gactggacatgagagccccttggtgccacagagggctgtgtcttactagaaacaacgcaa acctctccttcctcagaatagtgatgtgttcgacgttttatcaaaggccccctttctatg ttcatgttagttttgctccttctgtgtttttttctgaaccatatccatgttgctgacttt tccaaataaaggttttcactcctctaaaaaaaaaaaaaaaaaaaaa

Where are we now in collagen VI myopathies?  Collagen VI disorders are increasingly recognized  Likely among the most common muscular dystrophies/myopathies  Clinical spectrum expanding  Progression/prognosis are not well defined  No specific treatments  Treatments in development based on correction of abnormal mitochondrial function  Outcome measures for potential clinical studies are not well defined  How do we measure success of a particular therapy?

Where are we in genetics of Collagen VI  Dominant and recessive inheritance has been described for both BM and UCMD  Most mutations identified are specific to a single person/family  Variant vs. mutation is often unclear  Consistent genotype/phenotype correlations lacking

Collagen VI at the University of Utah  CLIA certified genetic testing has been available at the Utah Genome Center since 2006  To date, testing has been completed almost 400 patients.  Since patient samples are sent without clinical data we do not know the clinical history of these patients  Natural history and genotype/phenotype project  Re-contacting all patients who have had genetic testing for collagen VI to collect detailed clinical data allowing correlation with the genotype data already obtained.

United Dystrophinopathy Project  Multi-centered natural history and genotype/phenotype study  Now >1000 participants from 7 participating centers  Children's Hospital of Philadelphia, Philadelphia, PA  University of Minnesota, Minneapolis, MN  Nationwide Children's Hospital, Columbus, OH  University of Iowa, Iowa City, Iowa  University of Utah, Salt Lake City, UT  Washington University, St. Louis, MO  University of California, Davis, Sacramento, California  Patients are seen on yearly basis  Confirmation of genetic diagnosis

390 clinical samples genotyped 163 patients with variant detected 141 patients with no mutation detected 47 negative 39 positive 304 Full sequencing of COL6A1,2,3 86 Parent/sib carrier testing Of 163 with variant detected: 91 probably pathogenic, 72 unknown significance

Genes Muscle Patient COL6A

Collagen VI myopathy study at Utah  Catalog detailed clinical and genetic data in patients with Collagen VI myopathies  Clarify breadth of potential phenotypes  Detail natural history (progression over time)  Improve accuracy of genetic diagnosis and prognosis  Define genotype/phenotype relationships  Stimulate development of potential therapies  Provide a resource for investigators conducting clinical trials  Well defined cohorts  Appropriate outcome measures  Improved understanding of molecular pathogenesis  Facilitate collaboration among investigators, families, and others  Integration with CMDIR  Establishment of collaborations leaders in the field

Patient Recruitment  Primary recruitment from Utah Genome Center since Jan 2010  Over 400 patients with genetic testing since 2006 with 50 enrolled thus far  Goal is to re-contact patients for whom we have completed sequencing to collect clinical data  Primary contact is through referring physician  Anticipated expansion of enrollment to include any patient with collagen VI myopathy diagnosis  Summer 2010

Enrollment/Participation  All patients with collagen VI myopathy phenotypes (ie. Bethlem myopathy or Ullrich CMD) are eligible to enroll  A clinic visit is not required for participation  Participants will fill out a short questionnaire detailing symptoms and physical findings  We will request records from treating physicians including results of genetic testing (if done outside UGC) and other diagnostic tests  In some cases, we may request a sample from skin or muscle biopsy if they are already in existence

A couple areas of interest in our lab  Mutation negative collagen VI patients  46% patients with no identifiable mutation  Some of these with decreased collagen VI on muscle or skin biopsy  Potential explanations:  Deletion mutation not identifiable by sequencing from genomic DNA  Mutation in non-coding regulatory region  Allelic locus or secondary collagen VI defect  Non-collagen VI disorder  Defining pathogenicity (or non-pathogenicity) “variants”  163/304 samples with sequencing of all 3 COL6A genes identified variant  72 of these (44%) are of uncertain pathogenicity  High throughput genomics—transcriptome, exome sequencing

Acknowledgements  Utah Genome Center, Robert Weiss, Director  Weiss lab: Diane Dunn, Brett Duval  Kathryn Swoboda  Swoboda group: Lahdan Heidarian  Collaborators  Kevin Flanigan-Nationwide Children’s  Carsten Bönnemann-CHOP  Funding:  Muscular Dystrophy Association  NIH-Loan Repayment Program  Primary Children’ Foundation, CHRC Thank you to CureCMD for the opportunity to participate in this conference.