Introduction to Sizing DNA on an Agarose Gel HC 70AL Spring 2009 April 2, 2009 By Kristin Gill.

Slides:



Advertisements
Similar presentations
Our Proteins Jagged Protein Nicotinic ACh Receptor A7 Subunit Delta 1
Advertisements

DNA Techniques Lab Preparation 13-1 Manipulating Genes Genetic Engineering: You can repair genes, insert genes, excise genes or replace genes with gene.
Biotechniques. Gel electrophoresis Separates molecules according to size and charge. Different sized segments of DNA cut by restriction enzymes Segments.
Gel Electrophoresis of DNA
3.4.5 Define Genetic screening Testing individuals for the presence or absence of a gene Discuss 3 advantages and/or disadvantages of Genetic screening.
Cloning Worksheet Winter 2011 Producing a Standard Curve to Determine DNA Fragment Sizes.
1% Agarose Gel DNA Electrophoresis Running time : 52 minutes Distance measured from the well to the top of the second band: 4,5 cm Running voltage: 100.
Plasmid Miniprep. Broad and Long Term Objective To characterize a single clone from an To characterize a single clone from an Emiliania huxleyi cDNA library.
DNA-Fingerprint1 Detection of PCR Products by Agarose Gel Electrophoresis.
DNA Structure and Analysis
Lab 6: Molecular Biology Description – Gel electrophoresis cut DNA with restriction enzyme fragments separate on gel based on size.
DNA marker analysis Mrs. Stewart Medical Interventions Central Magnet School.
CISC667, F05, Lec3, Liao CISC 667 Intro to Bioinformatics (Fall 2005) Molecular Biology Tools Gel electrophoresis Cloning PCR DNA Sequencing.
Restriction Digestion of Arabidopsis thaliana Genomic DNA
EXPERIMENT OBJECTIVE: The objective of this experiment is to develop an understanding of DNA mapping by determining restriction enzyme cleavage sites.
Plasmid Miniprep. Broad and Long Term Objective To characterize a single clone from an Emiliania huxleyi cDNA library using sequence analysis To characterize.
Tutorial in Fast DNA Electrophoresis: Resolution of Larger DNA Fragments.
Introduction to DNA.
Agarose Gel Electrophoresis 1Dr. Nikhat Siddiqi. Agarose is a linear polymer made up of the basic repeating unit of agarobiose which comprises alternating.
What is Semi-Log Graph paper…. And WHY do I need to know?
Restriction Mapping of Plasmid DNA. Restriction Maps Restriction enzymes can be used to construct maps of plasmid DNA Restriction enzymes can be used.
Laboratory: Unit 3: agarose gels & sequencing template preparation (page 56) Lecture: review & agarose gel electrophoresis In-Class Writing: practice exam.
Big Idea 3 – Investigation (Lab) 9 We did a variation of this lab at the Cold Spring Harbor DNA Learning Center West… The next few slides highlight the.
Gel Electrophoresis of DNA
Biotechnology Introduction Gel Electrophoresis. Method of analyzing DNA Allows a researcher to determine how alike or different two samples of DNA are.
Lecture 3 Agarose Gel Electrophoresis Gel electrophoresis is a technique for the analysis of nucleic acids and proteins and preparation and analysis of.
DNA FINGERPRINTING. 1.What do you think DNA fingerprinting is? 2. What do you think DNA fingerprinting can be used for?
Biology 22 Molecular Laboratory Report 1. Bacterial Transformation 2. Plasmid Isolation 3. RFLP Analysis RESULTS ONLY due on April 21 st, 2011 Discussion.
Biology 22 Laboratory Report I 1. Bacterial Transformation 2. Plasmid Isolation 3. RFLP Analysis.
PCR is DNA replication in a test tube Ex. 25: PCR Based Testing for Water Contaminants Day 2.
Gel Electrophoresis.
(RFLP Electrophoresis)
Chapter 08 Author: Kelly Elkins © 2013 Elsevier, Inc. All rights reserved.
Restriction Digestion and Gel Electrophoresis Laboratory.
Gel Electrophoresis.
PCR and Electrophoresis. Techniques of Recombinant DNA Technology Multiplying DNA in vitro: The Polymerase Chain Reaction (PCR) VIDEO CLIP ◦Large number.
5‘- AGAGTTTGATCCTGGCTCAG - 3’ 1492R 5'- GGTTACCTTGTTACGACTT - 3’ 785F
How many base pairs (BP) long is each of the fragments (bands) in “your” gel? Pick an actual gel Develop, justify, and use a method Save the data “LAB.
Page Gel Electrophoresis gel electrophoresis – moving DNA through a gel medium using an electric current Why can we move DNA with electricity?
Restriction Mapping of Plasmid DNA. Restriction Maps Restriction enzymes can be used to construct maps of plasmid DNA Restriction enzymes can be used.
Gel Electrophoresis Biotechnology Unit. Principles of Electrophoresis Definition – Process in which particle, DNA, RNA and proteins- or their fragments.
Laboratory: Unit 4: PCR for T-RFLP (pages 83-84) Lecture: Terminal Restriction Fragment Length Polymorphism (T-RFLP) Analysis In-Class Writing: peer review.
CLONING DNA PART II. REVIEW: CHALLENGE REMEMBER THIS?
Gel Electrophoresis gel electrophoresis – moving DNA through a gel medium using an electric current Why can we move DNA with electricity? DNA has a negative.
Plasmids Small circular pieces of extra genomic DNA that can exit and enter bacterial cells.
DNA Fingerprinting. Why Use DNA Fingerprinting? DNA fingerprinting is a way of telling individuals of the same species apart DNA fingerprinting is a way.
Automated DNA Sequencing AP Biology Fall Automated DNA Sequencing  Currently, laboratories use automated DNA sequencing to determine the unknown.
…about graphing data -plot data on a graph with correct axes -include appropriate labels and units on a graph.
AMPLIFYING DNA A.Recombinant DNA B.Polymerase Chain Reaction (PCR) (animation)
Gel Electrophoresis UNIT 5 – DNA THIS IS ON THE WEBSITE SO YOU CAN USE IT FOR YOUR REPORT. Use this PowerPoint to complete writing you lab report. Lab.
Restriction Enzyme Digestion of Phage DNA
By Zainab sajjad (117114) Ayesha Rehman (117115)
Uses of Restriction Enzymes
PCR & electrophoreisis
Understanding Gel Electrophoresis
DATA ANALYSIS.
Molecular Biology Working with DNA.
© 2013 Elsevier, Inc. All rights reserved.
Small RNA Sample Preparation
Figure S1. A. B. C. (a) (b) 1-kbp marker bp marker 1-kbp marker
Sequencing and Copying DNA
© 2013 Elsevier, Inc. All rights reserved.
Restriction Digestion and Analysis of Lambda DNA Kit
Chapter 7 DNA Fingerprinting.
Genetic Engineering Terms: Plasmid
Simulating Genetic Screening
How to Make and Use a DNA Fragment Standard Curve
Molecular Biology Working with DNA.
Biotechnology: Restriction Enzyme Analysis of DNA
Gel Electrophoresis Analysis
Presentation transcript:

Introduction to Sizing DNA on an Agarose Gel HC 70AL Spring 2009 April 2, 2009 By Kristin Gill

How Do We Determine the Size of a PCR Product? Fractionate a PCR product along with a DNA ladder by gel electrophoresis Compare the migration distance of the PCR fragment to that of the DNA ladder

What Is a DNA Ladder? A DNA solution composed of many DNA fragments with different known lengths A ladder is used as a reference to estimate the size of an unknown DNA fragment

What Ladders Do We Use in This Laboratory? 1-kb ladder (Invitrogen) 600 bp 100 bp 1,500 bp 2,072 bp 12,216 bp 2,036 bp 1,636 bp 3,054 bp 1,018 bp 506/517 bp 396 bp 4,072 bp 100-bb ladder (Invitrogen)

How Can We Estimate the Size of the Unknown DNA Fragment? 1.Create a “standard curve” of DNA ladder fragments and their migration distance using either a logarithmic graph or an Excel program 2.Estimate the size of the unknown DNA fragment based on its migration distance relative to the standard curve

Creating a Standard Curve Measure how far each band traveled using a metric ruler (cm) Example: DNA Ladder Fragment Size (bp) Distance Traveled (cm)

Creating a Standard Curve Plot the data points using an Excel program Logarithmic Trend line

How Is the Size of the Unknown DNA Fragment Determined? Measure the distance traveled by the unknown fragment Interpolate the size based on the standard curve 875 Example: 2 cm Fragment size: 875 bp

Why Do You Need to Know the Size of the PCR Product? Sequencing! –The amount of DNA used in the sequencing reaction is determined according to the size of the fragment (in bp) recommended by Applied Biosystems’ protocol Size of PCR Product (bp) Amount of DNA Used in Sequencing Reactions ng ng ng ng (Taken from Experiment 1: Intro. to General Molecular…..Page 1.21)