Forensic DNA Analysis (Part II)

Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA and Statistics

Forensic DNA Analysis

Reading of Chapter 13 If material is more complicated than what we cover in class, it likely won’t be on a quiz or exam.

Collection of Evidence Forensic DNA Analysis Collection of Evidence Types of Unknown Samples: Blood, Semen, Stains, Saliva Hair, Tissue, Bones, Teeth Types of Known Samples: Blood or buccal swabs from suspect or victim or other known person

Beware of Contamination Forensic DNA Analysis Beware of Contamination Contamination occurs when DNA from another source gets mixed in with the sample being collected. An investigator touches, sneezes, bleeds on a sample. Wear gloves and use disposable instruments Package items separately. Especially, do not mix known samples (from victim or suspect) with unknown samples.

Packaging Evidence Package each item individually. Forensic DNA Analysis Packaging Evidence Package each item individually. Put evidence into paper bags, not plastic. Moisture degrades DNA; air dry samples. Keep samples at room temperature and out of sun.

Brief History of DNA - (1985) Forensic DNA Analysis > History Brief History of DNA - (1985) Multilocus RFLP Detects VNTRs: Variable Number of Tandem Repeats

Brief History of DNA (Late 80s, Early 90s) Forensic DNA Analysis > History Brief History of DNA (Late 80s, Early 90s) Single locus RFLP D2S44 probe Lanes 6 and 10 match Lanes 8 and 11 match

Brief History of DNA (Early 90s) Forensic DNA Analysis > History Brief History of DNA (Early 90s) PCR Strips (DQ alpha) 6 Alleles: 1.1, 1.2, 1.3 2, 3 or 4 A person can have one or two of these numbers.

Two main types (90s - Present): Forensic DNA Analysis > History Two main types (90s - Present): Short Tandem Repeats (STRs) Individual identification possible Samples: Blood stains, semen Mitochondrial DNA Used in cases of severely degraded DNA Individual identification not possible Samples: Bones, hair shafts

Short Tandem Repeats (STRs) Forensic DNA Analysis > STR Short Tandem Repeats (STRs) Currently the most used of all forensic markers Individual identification possible Type of data used in the FBI CODIS database People differ in length at these loci Are located in the nuclear DNA (chromosomes)

Short Tandem Repeats (STRs) Forensic DNA Analysis > STR Short Tandem Repeats (STRs) Person 1 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT.. 1 2 3 4 5 6 Person 2 ..GCCAGCTAGCTAGCTAGCTAGCTTTCAT.. 1 2 3 4 5 Person 3 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT.. 1 2 3 4 5 6 7

CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC Forensic DNA Analysis > STR Locus or Loci: Refers to the location on the chromosome. Allele: Refers to the type of DNA. For STRs, the allele will be the number of repeats. CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC

Example: Locus: D5S818 Alleles: 7,9 Forensic DNA Analysis > STR Paternal chromosome 5 CCAGATAGATAGATAGATAGATAGATAGATCC Maternal chromosome 5 CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC

Forensic DNA Analysis > STR 13 loci used in CODIS

Basic Steps in Analysis Forensic DNA Analysis > STR Basic Steps in Analysis Extraction: Separates DNA from sample Amplification or PCR: Amplifies small portions of DNA (STR regions) Separation: Separates amplified fragments according to size.

Basic Steps in Analysis Forensic DNA Analysis > STR Basic Steps in Analysis Extraction: Separates DNA from sample Amplification or PCR: Amplifies small portions of DNA (STR regions) Separation: Separates amplified fragments according to size.

Basic Steps in Analysis Forensic DNA Analysis > STR Basic Steps in Analysis Extraction: Separates DNA from sample Amplification or PCR: Amplifies small portions of DNA (STR regions) Separation: Separates amplified fragments according to size.

PCR Hood

The Thermal Cycler Amplifies DNA

Basic Steps in Analysis Forensic DNA Analysis > STR Basic Steps in Analysis Extraction: Separates DNA from sample Amplification or PCR: Amplifies small portions of DNA (STR regions) Separation: Separates amplified fragments according to size.

FMBIO Separates and Measures Amplified DNA

Forensic DNA Analysis > STR Color image of gel

Black and white image of STR gel. Forensic DNA Analysis > STR Gel Electrophoresis Black and white image of STR gel. Samples will have one or two bands at each loci.

Separates and Measures Amplified DNA ABI 310 Genetic Analyzer Separates and Measures Amplified DNA

Capillary Electrophoresis Forensic DNA Analysis > STR Capillary Electrophoresis Sample will have one or two peaks at each loci.

Compare to a ladder that has all peaks at each loci. Forensic DNA Analysis > STR Compare to a ladder that has all peaks at each loci.

DNA Profiles are compared Forensic DNA Analysis > STR DNA Profiles are compared TPOX CSF1PO D5S818 D8S1179 Blood stain 7,9 10,13 7,15 8,8 Suspect 1 8,9 10,10 9,10 11,12 Suspect 2 10,11 9,13 8,14 9,12 Suspect 3 7,9 10,13 7,15 8,8

DNA Profiles are compared Forensic DNA Analysis > STR DNA Profiles are compared TPOX CSF1PO D5S818 D8S1179 Blood stain 7,9 10,13 7,15 8,8 Suspect 1 8,9 10,10 9,10 11,12 Suspect 2 10,11 9,13 8,14 9,12 Suspect 3 7,9 10,13 7,15 8,8

Forensic DNA (mitochondria) Mitochondria - The powerhouse of the cell. Mitochondria have their own DNA Mitochondria

Mitochondrial DNA Forensic DNA Analysis > Mitochondrial Ring of DNA YES Double Helix YES Chromosomes NO

Mitochondrial DNA is only 16,569 letters long Forensic DNA Analysis > Mitochondrial Mitochondrial DNA is only 16,569 letters long [compared to 3 billion in nuclear DNA] There is a 900 base pair region with a 1.7% difference [D loop]

MtDNA used for old or degraded samples Forensic DNA Analysis > Mitochondrial Nuclear DNA vs. Mitochondrial DNA Double Helix Double Helix 46 Chromosomes One Ring Multiple copies in each mitochondria One copy per cell Multiple mitochondria in each cell MtDNA used for old or degraded samples

Different colored peaks correspond to a different base Forensic DNA Analysis > Mitochondrial Nuclear DNA: Length is measured mtDNA: Sequence is examined Different colored peaks correspond to a different base

Basic Steps in Analysis Forensic DNA Analysis > Mitochondrial Basic Steps in Analysis Extraction: Separates DNA from sample Amplification or PCR: Amplifies small portions of DNA (STR regions) Sequencing: Sequence of letters for amplified fragments

AGCTAGATCGTTATTCCGAG Forensic DNA Analysis > Mitochondrial DNA Sequences are compared AGCTAGATCGTTATTCCGAG Hair Sample AGCTAGATCGTTATTCCGAG Victim Conclusion: Hair may have come from the victim.

AGCTAGATTGTTATTCCGAG Forensic DNA Analysis > Mitochondrial DNA Sequences are compared AGCTAGATTGTTATTCCGAG Hair Sample AGCTAGATCGTTATTCCGAG Victim Conclusion: Hair did not come from the victim.

AGCTAGATTGTTATTCCGAG Forensic DNA Analysis > Mitochondrial DNA Sequences are compared AGCTAGATTGTTATTCCGAG Cigarette AGCTAGATCGTTATTCCGAG Suspect #1 AGCTAGATTGTTATTCCGAG Suspect #2 AGCTTGATTGTTATTCCGAG Suspect #3 AGCTAGATTGTTATTCCGAG Suspect #4 Conclusion: Cigarette could be from Suspect #2, Suspect #4 or other person with the same sequence.

DNA and Statistics The final result is presented as a statistic. Do not say: “The DNA in the bloodstain is John Doe’s DNA.” Do say: “The chance that another person has this DNA in the bloodstain is 1 in 300 billion.”

Where do the statistics come from? Forensic DNA Analysis > Statistics Where do the statistics come from? First, the frequency of each allele is estimated using data from a population data base. Allele frequency from database Locus: D5S818 7 26% Alleles: 7,9 9 11%

Where do the statistics come from? Forensic DNA Analysis > Statistics Where do the statistics come from? Next, the frequency of the genotype at each locus is calculated. Genotype frequency Locus: D5S818 Alleles: 7,9 7,9 6%

For total frequency, multiply all of the frequencies together. Forensic DNA Analysis > Statistics For total frequency, multiply all of the frequencies together. D5 = 6% D8 = 12% D18 = 0.5% Total = 0.004%

Demonstration Calculating Frequencies