Download presentation
Presentation is loading. Please wait.
Published byRonald Stewart Modified over 8 years ago
1
Forensic DNA Analysis (Part II)
2
Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA and Statistics
3
Forensic DNA Analysis
4
Collection of Evidence Types of Unknown Samples: Blood, Semen, Stains, Saliva Hair, Tissue, Bones, Teeth Types of Known Samples: Blood or buccal swabs from suspect or victim or other known person Forensic DNA Analysis
5
Beware of Contamination Contamination occurs when DNA from another source gets mixed in with the sample being collected. An investigator touches, sneezes, bleeds on a sample. Wear gloves and use disposable instruments Package items separately. Especially, do not mix known samples (from victim or suspect) with unknown samples. Forensic DNA Analysis
6
Packaging Evidence Package each item individually. Put evidence into paper bags, not plastic. Moisture degrades DNA; air dry samples. Keep samples at room temperature and out of sun. Forensic DNA Analysis
7
Short Tandem Repeats (STRs) Individual identification possible Samples: Blood stains, semen Mitochondrial DNA Used in cases of severely degraded DNA Individual identification not possible Samples: Bones, hair shafts Two main types (90s - Present): Forensic DNA Analysis > History
8
Short Tandem Repeats (STRs) Currently the most used of all forensic markers Individual identification possible Type of data used in the FBI CODIS database People differ in length at these loci Are located in the nuclear DNA (chromosomes) Forensic DNA Analysis > STR
9
Person 1..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT.. 1 2 3 4 5 6 Person 2..GCCAGCTAGCTAGCTAGCTAGCTTTCAT.. Person 3..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT.. 1 2 3 4 5 1 2 3 4 5 6 7 Short Tandem Repeats (STRs) Forensic DNA Analysis > STR
10
Locus or Loci: Refers to the location on the chromosome. Allele: Refers to the type of DNA. For STRs, the allele will be the number of repeats. CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC Forensic DNA Analysis > STR
11
Locus: D5S818 Alleles: 7,9 CCAGATAGATAGATAGATAGATAGATAGATCC Paternal chromosome 5 Maternal chromosome 5 CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC Example: Forensic DNA Analysis > STR
12
13 loci used in CODIS Forensic DNA Analysis > STR
13
Basic Steps in Analysis Extraction: Separates DNA from sample Separation: Separates amplified fragments according to size. Amplification or PCR: Amplifies small portions of DNA (STR regions) Forensic DNA Analysis > STR
14
Basic Steps in Analysis Extraction: Separates DNA from sample Separation: Separates amplified fragments according to size. Amplification or PCR: Amplifies small portions of DNA (STR regions) Forensic DNA Analysis > STR
15
Basic Steps in Analysis Extraction: Separates DNA from sample Separation: Separates amplified fragments according to size. Amplification or PCR: Amplifies small portions of DNA (STR regions) Forensic DNA Analysis > STR
16
PCR Hood
17
The Thermal Cycler Amplifies DNA
18
Basic Steps in Analysis Extraction: Separates DNA from sample Separation: Separates amplified fragments according to size. Amplification or PCR: Amplifies small portions of DNA (STR regions) Forensic DNA Analysis > STR
19
FMBIO Separates and Measures Amplified DNA
20
Color image of gel Forensic DNA Analysis > STR
21
Black and white image of STR gel. Samples will have one or two bands at each loci. Gel Electrophoresis Forensic DNA Analysis > STR
22
Blood stain 7,9 10,13 7,15 8,8 Suspect 18,9 10,10 9,10 11,12 Suspect 2 10,11 9,13 8,14 9,12 Suspect 37,9 10,13 7,15 8,8 TPOX CSF1PO D5S818 D8S1179 Forensic DNA Analysis > STR DNA Profiles are compared
23
Blood stain 7,9 10,13 7,15 8,8 Suspect 18,9 10,10 9,10 11,12 Suspect 2 10,11 9,13 8,14 9,12 Suspect 37,9 10,13 7,15 8,8 TPOX CSF1PO D5S818 D8S1179 Forensic DNA Analysis > STR DNA Profiles are compared
24
Forensic DNA (mitochondria) Mitochondria - The powerhouse of the cell. Mitochondria Mitochondria have their own DNA
25
Mitochondrial DNA Double Helix YES Chromosomes NO Ring of DNA YES Forensic DNA Analysis > Mitochondrial
26
Mitochondrial DNA is only 16,569 letters long There is a 900 base pair region with a 1.7% difference [D loop] [compared to 3 billion in nuclear DNA] Forensic DNA Analysis > Mitochondrial
27
Nuclear DNA vs. Mitochondrial DNA Double Helix One copy per cell Multiple copies in each mitochondria Multiple mitochondria in each cell One Ring46 Chromosomes MtDNA used for old or degraded samples Forensic DNA Analysis > Mitochondrial
28
Nuclear DNA: Length is measured mtDNA: Sequence is examined Different colored peaks correspond to a different base Forensic DNA Analysis > Mitochondrial
29
Basic Steps in Analysis Extraction: Separates DNA from sample Sequencing: Sequence of letters for amplified fragments Amplification or PCR: Amplifies small portions of DNA (STR regions) Forensic DNA Analysis > Mitochondrial
30
DNA Sequences are compared AGCTAGATCGTTATTCCGAG Hair Sample Victim Conclusion: Hair may have come from the victim. Forensic DNA Analysis > Mitochondrial
31
DNA Sequences are compared AGCTAGATTGTTATTCCGAG AGCTAGATCGTTATTCCGAG Hair Sample Victim Conclusion: Hair did not come from the victim. Forensic DNA Analysis > Mitochondrial
32
AGCTAGATTGTTATTCCGAG AGCTAGATCGTTATTCCGAG Cigarette Suspect #1 Conclusion: Cigarette could be from Suspect #2, Suspect #4 or other person with the same sequence. AGCTAGATTGTTATTCCGAG Suspect #2 AGCTTGATTGTTATTCCGAG Suspect #3 AGCTAGATTGTTATTCCGAG Suspect #4 Forensic DNA Analysis > Mitochondrial DNA Sequences are compared
33
DNA and Statistics The final result is presented as a statistic. Do say: “The chance that another person has this DNA in the bloodstain is 1 in 300 billion.” Do not say: “The DNA in the bloodstain is John Doe’s DNA.”
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.