1. Forensic DNA Analysis (Part II)

2. Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA and Statistics

3. Forensic DNA Analysis

4. Collection of Evidence Types of Unknown Samples:  Blood, Semen, Stains, Saliva  Hair, Tissue, Bones, Teeth Types of Known Samples:  Blood or buccal swabs from suspect or victim or other known person Forensic DNA Analysis

5. Beware of Contamination Contamination occurs when DNA from another source gets mixed in with the sample being collected.  An investigator touches, sneezes, bleeds on a sample.  Wear gloves and use disposable instruments  Package items separately.  Especially, do not mix known samples (from victim or suspect) with unknown samples. Forensic DNA Analysis

6. Packaging Evidence  Package each item individually.  Put evidence into paper bags, not plastic.  Moisture degrades DNA; air dry samples.  Keep samples at room temperature and out of sun. Forensic DNA Analysis

7. Short Tandem Repeats (STRs)  Individual identification possible  Samples: Blood stains, semen Mitochondrial DNA  Used in cases of severely degraded DNA  Individual identification not possible  Samples: Bones, hair shafts Two main types (90s - Present): Forensic DNA Analysis > History

8. Short Tandem Repeats (STRs)  Currently the most used of all forensic markers  Individual identification possible  Type of data used in the FBI CODIS database  People differ in length at these loci  Are located in the nuclear DNA (chromosomes) Forensic DNA Analysis > STR

9. Person 1..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT.. 1 2 3 4 5 6 Person 2..GCCAGCTAGCTAGCTAGCTAGCTTTCAT.. Person 3..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT.. 1 2 3 4 5 1 2 3 4 5 6 7 Short Tandem Repeats (STRs) Forensic DNA Analysis > STR

10. Locus or Loci: Refers to the location on the chromosome. Allele: Refers to the type of DNA. For STRs, the allele will be the number of repeats. CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC Forensic DNA Analysis > STR

11. Locus: D5S818 Alleles: 7,9 CCAGATAGATAGATAGATAGATAGATAGATCC Paternal chromosome 5 Maternal chromosome 5 CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC Example: Forensic DNA Analysis > STR

12. 13 loci used in CODIS Forensic DNA Analysis > STR

13. Basic Steps in Analysis Extraction: Separates DNA from sample Separation: Separates amplified fragments according to size. Amplification or PCR: Amplifies small portions of DNA (STR regions) Forensic DNA Analysis > STR

14. Basic Steps in Analysis Extraction: Separates DNA from sample Separation: Separates amplified fragments according to size. Amplification or PCR: Amplifies small portions of DNA (STR regions) Forensic DNA Analysis > STR

15. Basic Steps in Analysis Extraction: Separates DNA from sample Separation: Separates amplified fragments according to size. Amplification or PCR: Amplifies small portions of DNA (STR regions) Forensic DNA Analysis > STR

16. PCR Hood

17. The Thermal Cycler Amplifies DNA

18. Basic Steps in Analysis Extraction: Separates DNA from sample Separation: Separates amplified fragments according to size. Amplification or PCR: Amplifies small portions of DNA (STR regions) Forensic DNA Analysis > STR

19. FMBIO Separates and Measures Amplified DNA

20. Color image of gel Forensic DNA Analysis > STR

21. Black and white image of STR gel. Samples will have one or two bands at each loci. Gel Electrophoresis Forensic DNA Analysis > STR

22. Blood stain 7,9 10,13 7,15 8,8 Suspect 18,9 10,10 9,10 11,12 Suspect 2 10,11 9,13 8,14 9,12 Suspect 37,9 10,13 7,15 8,8 TPOX CSF1PO D5S818 D8S1179 Forensic DNA Analysis > STR DNA Profiles are compared

23. Blood stain 7,9 10,13 7,15 8,8 Suspect 18,9 10,10 9,10 11,12 Suspect 2 10,11 9,13 8,14 9,12 Suspect 37,9 10,13 7,15 8,8 TPOX CSF1PO D5S818 D8S1179 Forensic DNA Analysis > STR DNA Profiles are compared

24. Forensic DNA (mitochondria) Mitochondria - The powerhouse of the cell. Mitochondria Mitochondria have their own DNA

25. Mitochondrial DNA Double Helix YES Chromosomes NO Ring of DNA YES Forensic DNA Analysis > Mitochondrial

26. Mitochondrial DNA is only 16,569 letters long There is a 900 base pair region with a 1.7% difference [D loop] [compared to 3 billion in nuclear DNA] Forensic DNA Analysis > Mitochondrial

27. Nuclear DNA vs. Mitochondrial DNA Double Helix One copy per cell Multiple copies in each mitochondria Multiple mitochondria in each cell One Ring46 Chromosomes MtDNA used for old or degraded samples Forensic DNA Analysis > Mitochondrial

28. Nuclear DNA: Length is measured mtDNA: Sequence is examined Different colored peaks correspond to a different base Forensic DNA Analysis > Mitochondrial

29. Basic Steps in Analysis Extraction: Separates DNA from sample Sequencing: Sequence of letters for amplified fragments Amplification or PCR: Amplifies small portions of DNA (STR regions) Forensic DNA Analysis > Mitochondrial

30. DNA Sequences are compared AGCTAGATCGTTATTCCGAG Hair Sample Victim Conclusion: Hair may have come from the victim. Forensic DNA Analysis > Mitochondrial

31. DNA Sequences are compared AGCTAGATTGTTATTCCGAG AGCTAGATCGTTATTCCGAG Hair Sample Victim Conclusion: Hair did not come from the victim. Forensic DNA Analysis > Mitochondrial

32. AGCTAGATTGTTATTCCGAG AGCTAGATCGTTATTCCGAG Cigarette Suspect #1 Conclusion: Cigarette could be from Suspect #2, Suspect #4 or other person with the same sequence. AGCTAGATTGTTATTCCGAG Suspect #2 AGCTTGATTGTTATTCCGAG Suspect #3 AGCTAGATTGTTATTCCGAG Suspect #4 Forensic DNA Analysis > Mitochondrial DNA Sequences are compared

33. DNA and Statistics The final result is presented as a statistic. Do say: “The chance that another person has this DNA in the bloodstain is 1 in 300 billion.” Do not say: “The DNA in the bloodstain is John Doe’s DNA.”