COMPARATIVE FUNGAL GENOMICS : KNOWN KNOWNS & KNOWN UNKNOWNS. Josh Herr, Plant Biology Interdepartmental Program.

Slides:

Advertisements

Similar presentations

MYB Family Transcription Factors Jonathan Russell Rena Schweizer Mike Douglas.

Advertisements

1 Orthologs: Two genes, each from a different species, that descended from a single common ancestral gene Paralogs: Two or more genes, often thought of.

Phylogenetic analysis To infer and study evolutionary history of homologous gene families Manuel Ruiz (CIRAD, Data Integration team) Alexis Dereeper (IRD)

Work presentation Gaurav Moghe Feb 4 th, 2008 – March 17 th, 2008.

Phylogenetics workshop: Protein sequence phylogeny week 2 Darren Soanes.

Gramene Comparative & Phylogenomics Resources for Plants Joshua C. Stein 1, William Spooner 1, Sharon Wei 1, Liya Ren 1, Doreen Ware 1,2 1 Cold Spring.

Whole Genome Sequencing &Crop Genetic Breeding Presentation: Wenhui Gao

Life through a cytochrome P450 lens David R. Nelson University of Tennessee, Memphis.

Orthology, paralogy and GO annotation Paul D. Thomas SRI International.

Comparative genomics Joachim Bargsten February 2012.

Psi-BLAST, Prosite, UCSC Genome Browser Lecture 3.

Molecular Clock I. Evolutionary rate Xuhua Xia

Readings for this week Gogarten et al Horizontal gene transfer….. Francke et al. Reconstructing metabolic networks….. Sign up for meeting next week for.

Computational Molecular Biology (Spring’03) Chitta Baral Professor of Computer Science & Engg.

Biological Databases Notes adapted from lecture notes of Dr. Larry Hunter at the University of Colorado.

Cytochrome P450 Monooxygenases

Subsystem Approach to Genome Annotation National Microbial Pathogen Data Resource Claudia Reich NCSA, University of Illinois, Urbana.

Arabidopsis Gene Project GK-12 April Workshop Karolyn Giang and Dr. Mulligan.

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

Comparative Genomics of the Eukaryotes

Comparative genomics provides new insights into protein degradation in plants Contact: Xiaohan Yang, DOE/Office of Science/Biological.

T-COFFEE Multiple Alignments of Orthologous Sequences Horizontal Gene Transfer (Phylogenetic Trees) WebLogo.

Pollen transcript unigene identifier log 2 -fold change Annotation (BLAST) Unigene L. longiflorum chloroplast, complete genome Unigene

Identification of Protein Domains. Orthologs and Paralogs Describing evolutionary relationships among genes (proteins): Two major ways of creating homologous.

Figure S1_Yao Qin et al. Figure S1 Occurrence and distribution of trihelix family in different plant species. Red branches in the cladogram indicate that.

20.1 Structural Genomics Determines the DNA Sequences of Entire Genomes The ultimate goal of genomic research: determining the ordered nucleotide sequences.

ANALYSIS AND VISUALIZATION OF SINGLE COPY ORTHOLOGS IN ARABIDOPSIS, LETTUCE, SUNFLOWER AND OTHER PLANT SPECIES. Alexander Kozik and Richard W. Michelmore.

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

Protein and RNA Families

Characterization of RDR Gene Expression Johnny R. Nunez and Lisa K. Johansen Community College of Denver and University of Colorado at Denver and Health.

Basic Local Alignment Search Tool BLAST Why Use BLAST?

Molecular and Genomic Evolution Getting at the Gene Pool.

Laura McCoy.  rRNA genes are a multi-gene family  Located in the nucleolus of the cell  Genes are found in tandem arrays  rRNA plus ribosomal proteins.

The “ABC’s” of Floral Madness Architecture of a Prototypical Problem Space John Greenler and Doug Green.

ABSTRACT Isolation and phylogeny of endogenous retroviral elements belonging to the HERV-K LTR in cDNA library of human fetal brain and X q 21.3 region.

Globins. Globin diversity Hemoglobins ( , etc) Myoglobins (muscle) Neuroglobins (in CNS) Invertebrate globins Leghemoglobins flavohemoglobins.

Biological Networks.

Coat Color in Vaccinium corymbosum Aaron Deal

You have worked for 2 years to isolate a gene involved in axon guidance. You sequence the cDNA clone that contains axon guidance activity. The sequence.

PROTEIN STRUCTURE (Donaldson, March 10,2003) What are we trying to learn about genes and their proteins: Predict function for unknown protein by comparison.

Welcome to the Protein Database Tutorial. This tutorial will describe how to navigate the section of Gramene that provides collective information on proteins.

Cytochrome P450 Monooxygenases William Green Leland Taylor 4/12/11.

Graduate Research with Bioinformatics Research Mentors Nancy Warter-Perez, ECE Robert Vellanoweth Chem and Biochem Fellow Sean Caonguyen 8/20/08.

Comparative Genome Analysis and Genome Evolution of Members of the Magnaporthaceae Family of Fungi.

The Evolution and Genomics of Cytochrome P450 David R. Nelson University of Tennessee Health Science Center Memphis UTSA Dept. of Chemistry April 20, 2007.

Bioinformatics What is a genome? How are databases used? What is a phylogentic tree?

Functional characterization of the Nicotiana benthamiana chromomethyltransferase gene, NbCMT3, in developmental programs by virus-induced gene silencing.

Sequence similarity, BLAST alignments & multiple sequence alignments

Evolutionary genomics can now be applied beyond ‘model’ organisms

Emily Eder HC70AL - Spring 2005

Gapless genome assembly of Colletotrichum higginsianum reveals chromosome structure and association of transposable elements with secondary metabolite.

Sarina Pollat1, Luke Wheeler2, Michael Harms2

Functional analysis for this locus

Phylogenetic analysis of CADs and oxidoreductases involved in specialized metabolism (ORSMs). Phylogenetic analysis of CADs and oxidoreductases involved.

Genome Projects Maps Human Genome Mapping Human Genome Sequencing

Figure 3 Metabolism pathway of antiplatelet agents

Predicting Active Site Residue Annotations in the Pfam Database

Nat. Rev. Cardiol. doi: /nrcardio

What do you with a whole genome sequence?

SIFGD: Setaria italica Functional Genomics Database

BSC1010: Intro to Biology I K. Maltz Chapter 21.

Systemin/Jasmonate-Mediated Systemic Defense Signaling in Tomato

Unit Genomic sequencing

.1Sources of DNA and Sequencing Methods 2 Genome Assembly Strategy and Characterization 3 Gene Prediction and Annotation 4 Genome Structure 5 Genome.

Part II SeqViewer AraCyc Help

Study phylogeny in the context of species evolution

Schematic representation of a transcriptomic evaluation approach.

Construction of a Rice Glycosyltransferase Phylogenomic Database and Identification of Rice-Diverged Glycosyltransferases Cao Pei-Jian , Bartley Laura.

Volume 11, Issue 7, Pages (May 2015)

Volume 1, Issue 5, Pages (September 2008)

Presentation transcript:

COMPARATIVE FUNGAL GENOMICS : KNOWN KNOWNS & KNOWN UNKNOWNS. Josh Herr, Plant Biology Interdepartmental Program

Problems, hurdles, help wanteds…  No developed fungal genome browser? Gbrowse?  Data can be acquired – which format to use? raw nucleotide, GFF3, PEP, GBK  Which genes to compare? (remember: annotation is a problem) ex: aquaporin genes, fruitbody morphogenesis?  How do we get a grip on purifying (or other?) selective forces in the fungi?  How do we work with the data? BLAST and then Galaxy, but what else? Whole genome MUSCLE alignments?

COMPARATIVE FUNGAL GENOMICS : KNOWN KNOWNS & KNOWN UNKNOWNS. Josh Herr, Plant Biology Interdepartmental Program

COMPARATIVE GENOMICS OF SOME PLANT GENES RESPONDING TO FUNGI: AN EXAMPLE FROM THE ALLENE OXIDE SYNTHASE GENE FAMILY. Josh Herr, Plant Biology Interdepartmental Program

Modified from Finlay 2008

Photo: David Read

Induced Systemic Resistance (ISR) From: Harman et al 2004 Nat. Rev. Microbiol.

From: Schilmiller & Howe (2005)

Allene Oxide Synthase (AOS)  AOS is a member in a large Cytochrome p450 enzyme class responsible for fatty acid metabolism.  Member of the CYP74 family of oxygen- binding Heme-like lipoxygenase proteins.  Best characterized member of this group is the thromboxane synthase enzyme in Humans which mediates blood platelet aggregation.

Using RT-PCR to measure gene expression in plants with mycorrhizae.  Extract RNA from Poplar trees with and without symbiotic fungi on roots.

Using RT-PCR to measure gene expression in plants with mycorrhizae.  Extract RNA from Poplar trees with and without symbiotic fungi on roots.  Make cDNA library.  Measure gene expression.

Characterization of AOS gene family  Itoh et al 2002 describe 3 proteins in gene family (AOS1, AOS2, HPL) in Arabidopsis.  Numerous studies have cited AOS, but no phylogeny exists in plants.  Research Goal: To determine the number of homologs of AOS in plants and understand the gene evolution, eventually designing primers to address gene expression across this family.

Characterization of AOS gene family (con’t)  BLAST known AOS sequence across plant genomes.  Take close hits, align, and construct phylogeny.  Determine synteny for AOS family genes across the plant lineage (problem: only whole genome alignments are Arabidopsis, Oryza, and Populus.)  Eventually develop primers to determine gene expression of individual members of this family.

HPL (hydroperoxide lyase) DEL (divinyl ether synthase) AOS3 (allene oxide synthase 3) AOS2 (allene oxide synthase 3) AOS1 (allene oxide synthase 1)

Basal gene: hydroperoxide lyase (HPL)

AOS3 / divinyl ester synthase (DES)

AOS2

AOS1

Distant relative is conserved: thromoxane synthase.

Conclusions?  There are at least three paralogous members of the AOS gene family (AOS1, AOS2, DES/AOS3, and HPL(?).  These genes appeared to have diverged in the basal plants (i.e. orthologous gene alignment across plants).  Next goal is to design primers to study gene expression of the individual members of this gene family.

Questions?