HBV/HIV co-infections: molecular and biological characterization of occult HBV strains or strains resistant to antiviral treatment ANRS N°12149 Selma de ANDRADE GOMES Lab. de Virologia Molecular IOC-FIOCRUZ Alan KAY Centre de Recherche en Cancérologie de Lyon (INSERM U1052) ANRS/Programa Nacional DST/AIDS Evaluation Meeting, Rio de Janeiro, 4-5 April 2011

History of the collaboration In the early 2000s, our laboratory in Lyon was actively working on the problem of occult Hepatitis B Virus (HBV) infections: Chemin, I., Zoulim, F., Merle, P., Arkhis, A., Chevallier, M., Kay, A., Cova, L., Chevallier, P., Mandrand, B., Trepo, C., 2001. High incidence of hepatitis B infections among chronic hepatitis cases of unknown aetiology. J Hepatol 34, 447-454. Chemin, I., Jeantet, D., Kay, A., Trepo, C., 2001. Role of silent hepatitis B virus in chronic hepatitis B surface antigen(-) liver disease. Antiviral Res 52, 117-123  Jeantet, D., Chemin, I., Mandrand, B., Zoulim, F., Trepo, C., Kay, A., 2002. Characterization of two hepatitis B virus populations isolated from a hepatitis B surface antigen-negative patient. Hepatology 35, 1215-1224 In Rio de Janeiro at the same time, Selma GOMES was also working on occult HBV infections, and more specifically in HIV co-infected patients:  Gomes, S.A., Yoshida, C.F., Niel, C., 1996. Detection of hepatitis B virus DNA in hepatitis B surface antigen-negative serum by polymerase chain reaction: evaluation of different primer pairs and conditions. Acta Virol 40, 133-138  Santos, E.A., Yoshida, C.F., Rolla, V.C., Mendes, J.M., Vieira, I.F., Arabe, J., Gomes, S.A., 2003. Frequent occult hepatitis B virus infection in patients infected with human immunodeficiency virus type 1. Eur J Clin Microbiol Infect Dis 22, 92-98  Santos, E.A., Sucupira, M.V., Arabe, J., Gomes, S.A., 2004. Hepatitis B virus variants in an HIV-HBV co-infected patient at different periods of antiretroviral treatment with and without lamivudine. BMC Infect Dis 4, 29 Selma contacted our laboratory, and I visited Selma’s lab in 2005 We decided to apply for an INSERM/FIOCRUZ exchange agreement

HBV infection 350 million chronic HBV patients > 10 times the number of HIV patients  8%: High 2-7%: Intermediate Brazil – Intermediate to high < 2%: Low

Geographic distribution of HBV genotypes Pujol and Devesa (2005) J Clin Gastroenterol. 39:611-8.

What is occult HBV infection? HBV DNA Acute infection: rapid loss (<6 months) of surface antigen (HBsAg) and HBV DNA Chronic infection: persistence (>6 months) of HBsAg, persistence of HBV DNA Occult HBV infection: detectable HBV DNA, HBsAg undetectable  DNA levels usually very low (<1000 copies/ml)  the virus can be transmitted  retains the oncogenic potential of chronic HBV infections

Occult HBV infection in the literature over years More Than 240 Number of publications 140 2005-07 120 100 80 60 40 20 1980-89 1990-99 2000-04 2008-10 Chemin & Trepo J Clin Virol 2005, Adapted Raimondo et al, J Hepatol 2008

Occult HBV and HIV co-infection Study Country N° patients Occult HBV N° (%) Hofer, 1998 Torres-Baranda, 2006 Filippini, 2006 Mphahlele, 2006 Pogany, 2005 Neau, 2005 Santos, 2003 Wagner, 2004 Goncales, 2003 Nunez, 2002 Piroth, 2000 Raffa, 2007 Switzerland Mexico Italy South Africa Netherlands France Brazil Spain 57 35 86 140 93 160 101 30 159 85 37 51 (89%) 7 (20%) 17 (20%) 31 (22.%) 4 (4%) 1 (0.6%) 11 (37%) 16 (16%) 8 (5%) 13 (35%) 42 (41%) Methods “nested” PCR (serial evaluation) “nested” PCR (liver) single step PCR Cobas Amplicor HBV Monitor (Roche) Raimondo et al, J Hepaol 2007, modified

In Vitro Complementation and Ligation Rolling circle amplification (RCA) A new tool for amplifying full-length HBV genomes by completion and ligation of HBV RC-DNA to cccDNA T4 DNA polymerase + T4 DNA ligase Hybridization minus-strand primers DR1 DR1 DR2 DR2 HBV RC-DNA In Vitro Complementation and Ligation HBV ccc-DNA Elongation minus-strand DNA Strand Displacement Hybridization plus-strand primers End product – High molecular weight double-stranded DNA d.

Illustration of RCA Agarose gel of RCA products M H2O 103 102 10 1 0 Copies / reaction Agarose gel of RCA products Southern blot of gel – HBV has been succesfully amplified Unit-length HBV genomes can be excised from RCA products – can be dirctly cloned and/or sequenced Sensitivity can be increased by doing A genomic PCR on RCA products 10 kb 3 kb HBV genome (3.2 kb) 3 kb HBV genome (3.2 kb)

1) Reactivation of an occult HBV infection in a HIV+ patient Applications 1) Reactivation of an occult HBV infection in a HIV+ patient Patient HIV+, anti-HBc+, anti-HBs+ - profile resolved acute HBV infection? Reactivated occult HBV infection after glucocorticoid treatment Amplified, cloned and sequenced full-length HBV genomes after RCA Genomes are of subgenotype A2 (European genotype A) No drug resistance mutations despite poor compliance of patient Genomes viable – replication competent, secrete viral particles What causes immune-escape from anti-HBs? ● all genomes contain 2 significant mutations in the S gene ● K122R – very rare in genotype A ● D144E – potential immune-escape mutant

Seroconversion to a-HBe What can the patient’s serum recognize? Genetically engineered genomes so that they express viral particles of wild-type HBsAg sequence, with K122R, D144E or both Transfected into cells, labeled with 35S-Met/Cys, immuno-precipitated secreted viral particles K122/D144 K122R/D144 K122/D144E K122R/D144E C- C+ P C- C+ P C- C+ P C- C+ P C- = Normal human serum C+ = Serum from a vaccinated person P = Patient’s serum HBsAg Acute Infection < 6 Mo Emergence of K122R. Low-level HBV replication HIV+ Wild-type Virus K122/D144 Occult > 12 Yrs Glucocorticoid treatment 6 Mo 1 Mo Stimulation of HBV replication. D144E Reactivation 2 Mo K122R/D144E Antiviral treatment Seroconversion to a-HBe HBV-

2) Mutations associated with HBeAg-negativity in subgenotype F2 Applications 2) Mutations associated with HBeAg-negativity in subgenotype F2 prevalent in Brazil HBeAg-negative mutants – important global health problem Stop codon position 28 of precore region - not possible for genotype A or F2 Anna KRAMVIS – subgenotype A1 – mutations in core promoter/precore region 1762 1764 1809 1812 1814 1858 1862 1896 1901 A G GCAC ATG T G TGG ATG Precore HBcAg T A T T C T A Core promoter Genotype A Subgenotype F2 HBV RC-DNA DR1 DR2 1901 1762 Spe I RCA Spe I 1762 Full-length HBV genome

Amplification and sequencing of genotype F genomes H20 RCA cut Spe I HBV full-legth genome RCA then genomic PCR using primers at Spe I site HBV full-legth genome #1 GGGGGAGGAGATTAGGTTAAAGGTCTTTGTATT//CCAGCACCATGCAA//CCCACTGTT//CTTTGGGGCATGGAC #2 GGGGGAGGAGATTAGGTTAAAGGTCTTTGTATT//CCAGCACCATGCAA//CCCACTGTT//CTTTGGGGCATGGAC #3 GGGKGAGGAGASTAGGTTAATGGTTTATGTATT//CCAGCACCATGCAA//CCCACTGTT//CTTTGGGACATGGAC #4 GGGKGAGGAGASTAGGTTAATGGTTTATGTATT//CCAGCACCATGCAA//CCCACTGTT//CTTTGGGACATGGAC F2 GGGGGAGGAGATTAGGTTAAAGGTCTTTGTATT//CCAGCACCATGCAA//CCCACTGTT//CTTTGGGGCATGGAC 1762 1764 1809 1812 1814 1858 1862 1896 1901 Precore HBcAg Subtype F2 genomes do not show the mutations found with subtype A1 Some isolates (#3 & 4) have A1762T but not G1764A Isolates #3 & 4 have other mutations before and after 1762/1764 Also have mutated codon 29 (GGC  GAC, Glycine  Tyrosine) More work needed (sequence complete genomes, study HBeAg expression)

HBV-HIV co-infection HIV interferes with the natural history of HBV infection by enhancing HBV replication, leading to more severe liver disease, decreasing hepatitis B ‘e’ antigen seroconversion and increasing HBV DNA levels Due to the shared modes of transmission of HBV and HIV, the prevalence of HBV infected patients is higher than in non-HIV infected individuals Occult HBV infection = Detection of HBV DNA in absence of HBsAg Possible explanations: Low rate of HBV replication, mutations that inhibit HBsAg expression or change HBsAg antigenicity, thus preventing detection by commercial assays. Among HIV-infected cohorts, occult HBV infection prevalence is widely divergent, ranging from 0% to 89%. Nós nos interessamos na co-infecção HBV HIV pois..slide Jeantet et al., 2002

Demographical and serological data of HIV positive/ HBsAg negative patients characteristics Years 1988-1999 n = 91 2000-2003 n = 33 Year 2006 n=43 2009 n=144 Sex Male Female 80 (88%) 11(12%) 21 (64%) 12(36%) 35 (81%) 8 (19%) 59 (41%) 85 (59%) Age (years) < 30 30-39 40-49 >49 2 (3%) 21 (29.5%) 32 (45%) 16 (22.5%) 3 (10%) 16 (51.5%) 8 (25.5%) 4 (13%) 0 (0%) 7 (16.5%) 19 (45.5%) 16 (38%) 24 (19%) 42 (33.3%) 40 (31.7%) 20 (16%) Antiretroviral treatment Yes No 26 (31%) 58(69%) 26 (78%) 7 (22%) 39 (90%) 4 (10%) 105 (82%) 23 (18%) Lamivudine 33 (36%) 58 (64%) 23 (70%) 10(30%) 37 (95%) 2 (5%) 103 (80%) 25 (20%) TDF 10 (23%0 40 (30%) HBV markers Anti-HBc total 87 (97%) 26 (81%) 39 (91%) 23 (16%) Anti-HBc only 34/89 (38%) 8/30 (26%) 11/42 (26%) 4/144 (3%) Anti-HBs/Anti-HBc 53 (59.5) 18 (60%) 28 (66.5%) 19 (13.5%) Anti-HBs only 2/89 (2%) 1/32 (3%) 3/42 (7%) 37/144 (28%) No HBV serological marker 3/32 (3%) 84/144 (58%) HBV DNA Pre S or S region 05 (5.5%) 06 (18%) 06 (14%) 05 (3.3%) Estudamos coortes hbv/hiv ao longo do tempo (slide) HBsAg >10% (1998-2003), 2% 2009-2010

Serological and molecular features of HBV isolates from cases of occult infection Patient Sex Year Antiretroviral treatment LAM/TVF Anti-HBs/Anti-HBc HBV loads (copies/mL) Genotypes S STOP CODONS Other mutations G M 1998 Y N/N Pos/Pos 104 A/A1 S36 - P36 F 2006 Y/N 106 S216 Y100C P 1999 N S187 P51 Neg/Pos No Y100C,*E164D 21967 2009 ND Q101H F134L H 1997 P65 A/A2 23818 Neg/Neg 2003 102 D T118V, A128V E S136Y * LAM triple mutation HindIII Isolados de HBV caracterizados de casos de infecção oculta: stop codon outras, algumas expressas EcoRV HindIII EcoRV Transfection of eukariotic cells (CHO or HUH7) pre-S2 S HindIII EcoRV pcDNA3 S BIOELISA HBsAg Colour (Biokit)

Expression of HBsAg containing Y100C variant frequently detected in occult HBV infection

Conclusions/Perspectives Ongoing studies at IPEC-Fiocruz should confirm or not the recent decrease of HBV prevalence in the HIV infected Brazilian population, observed by us. Drug resistance: In agreement with dr. Couto-Fernandez (member of National Network for HIV Genotyping Lab. AIDS, IOC) we had designed a doctoral thesis to study the lamivudine and tenofovir resistance mutations of both HIV and HBV (populations and subpopulations by pyrosequencing) in cases of co-infectin. Unfortunately, the collaboration did not happen. We are inviting co-infected patients from IPEC to initiate this study. Regiã Pol HIV

Conclusions/Perspectives Studies of occult HBV infection in the sera and PBMC of HIV co-infected patients will also be carried out in France Future studies are needed to monitor transmission of HBV isolates from cases of occult infections/drug resistance The most appropriate therapy for a particular genotype or a mutation type may be identified by in vitro phenotyping Test: Transfection of complete genomes into human cells in the presence of drugs The study of mutations affecting HBeAg expression in Brazilian-specific genotypes/subtypes will also be continued

Valorization of the project (1) Publications Mello, Francisco C. A. ; Martel, Nora ; Gomes, Selma A. ; Araujo, Natalia M. .Expression of Hepatitis B Virus Surface Antigen Containing Y100C Variant Frequently Detected in Occult HBV Infection. Hepatitis Research and Treatment, v. 2011, p. 1-4, Araujo, N. M. ; Branco-Vieira M ; Silva ACM ; Pilotto JH ; Grinsztejn B ; Trepo C; Gomes, SA . Occult hepatitis B virus infection in HIV-infected patients:Evaluation of biochemical, virological and molecular parameters.. Hepatology Research, v. 38, p. 1194-1203, 2008 Araujo NM, Waizbort R, Kay A. Hepatitis B Virus infection from an evolutionary point of view: how viral, host, and environmental factors shape genotypes and subgenotypes. Infectious, Genetics and Evolution, 2011. (under revision) 2 other papers in preparation 1 Brazilian patent deposited 1 thesis in co-tutelle Instituo Oswaldo Cruz/Université Claude Bernard Lyon 1

PhD student, ANRS doctoral bursary Valorization of the project (2) A mini-symposium organized by Selma GOMES: “International Conferences and Debates on Relevant Aspects of Viral Hepatitis” IOC-FIOCRUZ, Rio de Janeiro, Brazil, February 26ty 2010 Participants: Selma GOMES, IOC-FIOCRUZ, Brazil: Introduction Anna KRAMVIS, Witwatersrand University, Johannesburg, South Africa: Phylogeny of Hepatitis B Virus Stephen Locarnini, Victoria Infectious Diseases Reference Laboratory, Melbourne, Australia: Drug resistance of Hepatitis B Virus Christoph COMBET, IBCP, Lyon, France: Hepatitis C virus genomic variability Alan Kay, INSERM U871, Lyon, France:Cell-culture models for HBV infectivityulture models for HBV infectivity Exchanges Rio de Janeiro  Lyon Lyon  Rio de Janeiro Natalia ARAUJO Caroline SOARES Nora MARTEL PhD student, ANRS doctoral bursary Joint thesis IOC/UCBL1

Research team/ Acknowledgment Brazilian team Researcher Dr. Natalia M. Araujo PHD students Kelly C. Pereira French team Researchers/clinicians Dr Isabelle Chemin Pr. Christian Trepo Dr. Laurent Cotte Dr. Sophie Allain (Limoges PHD student Nora Martel Collaborators (cohort of patients) IPEC/Fiocruz (Dr.Beatriz Grinsztejn, Dr.Juçara Arabe Other Financial Support Brazil: CNPq/ France/Brazil: INSERM/FIOCRUZ