بسم الله الرحمن الرحيم (وإن لكم في الأنعام لعبرة نسقيكم مما في بطونه ، من بين فرث ودم لبناً خالصاً سائغاً للشاربين ) سورة النحل آيه (66)

Slides:

Advertisements

Similar presentations

Diagnosis with PCR This is a preparation of DNA. We zoomed in a portion of a gene. We know that two primers, Forward and Reverse, will hybridize at specific.

Advertisements

PCR way of copying specific DNA fragments from small sample DNA material "molecular photocopying" It’s fast, inexpensive and simple Polymerase Chain Reaction.

Detection of the human Mitochondrial DNA A Polymerase Chain Reaction Experiment.

COMPUTER EXERCISE Design of PCR and PCR-RFLP experiments This presentation shows all steps of a PCR-RFLP experiment and is a companion of the computer.

Lobna Al juffali,Msc.  Brucellosis is a worldwide zoonosis caused by infection with the bacterial genus Brucella.  It is primarily a contagious disease.

21/1/2008Dr. Salwa Tayel (Brucellosis)1. 21/1/2008Dr. Salwa Tayel (Brucellosis)2 Associate Professor Family and Community Medicine Department King Saud.

Brucellosis Eradication Program 4-H Veterinary Science Extension Veterinary Medicine Texas AgriLife Extension Service College of Veterinary Medicine and.

Brucellosis By: Leah Kasheta.

Carlee Holden Shay Mueller

Comparison of the Diagnostic Value of the Standard Tube Agglutination Test and the ELISA IgG and IgM in Patients with Brucellosis Presented by Dr. Md.

Genomic DNA purification

Department of Clinical Laboratory Sciences, College of Applied Medical Sciences, Al Jouf University.

Laboratory Training for Field Epidemiologists Polymerase Chain Reaction Investigation strategies and methods May 2007.

Polymerase Chain Reaction

APPLICATIONS OF MOLECULAR BIOLOGY TECHNIQUES TO MEDICAL MICROBIOLOGY.

PCR POLYMERASE CHAIN REACTION Dauphin Island Graduate Neurobiology.

Ovine Epididymitis: Brucella ovis

By: Kelly and Kathryn PCR. What exactly is PCR? PCR stands for “polymerase chain reaction” and is a lab technique used to clone segments of DNA. Two main.

Food Borne Presentation ChefTiffine. Brucella Brucella is the cause of brucellosis. It is caused by eating infected food, direct contact with a sick animal.

Comparison of the diagnostic value of STA test and ELISA IgG and IgM in patients with Brucellosis Mustafa Ertek, Halil Yzgi, Zulal Ozkart et al. Turk.

Polymerase Chain Reaction Mrs. Stewart Medical Interventions.

What do these terms mean to you? You have 5 min to discuss possible meanings and examples with your group! DNA sequencing DNA profiling/fingerprinting.

Research on Brucella Abortus

Brucellosis A zoonosis. Center for Food Security and Public Health Iowa State University Brucella spp. Gram negative, coccobacilli bacteria Facultative,

PCR Troubleshooting Virginia Balke

Chapter 14: DNA Amplification by Polymerase Chain Reaction.

Tina Doss Applied Biosystems

بسم الله الرحمن الرحيم Medical mycology LAB 9 Dalia Sarar.

PCR Forensics. Today’s Lab There has been an outbreak of Salmonella poisoning in the Student Union cafeteria at Stanford University cafeteria. You have.

Brucellosis The disease and Panbio product training.

Comparison of the diagnostic value of STA test and ELISA IgG and IgM in patients with Brucellosis Mustafa Ertek, Halil Yzgi, Zulal Ozkart et al. Turk J.

BRUCELLOSIS. Overview Brucellosis, also called undulant or Malta fever, is a prolonged febrile disease involving the reticuloendothelial system and is.

GENUS: BRUCELLA Prof. Khalifa Sifaw Ghenghesh بسم الله الرحمن الرحيم.

FOOD BORNE PRESENTATION Chef Marissa. Brucella Brucella can come from sheep, goats, cattle, deer, elk, pigs, dogs, and several other animals. We get it.

The polymerase chain reaction

Brucellosis Dr. Zahoor.

The polymerase chain reaction

Polymerase Chain Reaction: “DNA Photocopying” SBI4U AP Mr. McCrorie.

Amplification of a DNA fragment by Polymerase Chain Reaction (PCR) Ms. Nadia Amara.

Molecular Genetic Technologies Gel Electrophoresis PCR Restriction & ligation Enzymes Recombinant plasmids and transformation DNA microarrays DNA profiling.

1. Bacterial strains 35 Brucella culture isolates obtained from patients diagnosed with brucellosis were grown on chocolate agar media and the plates were.

Crime Scene Investigator PCR Basics™

Polymerase Chain Reaction (PCR). What’s the point of PCR? PCR, or the polymerase chain reaction, makes copies of a specific piece of DNA PCR allows you.

Brucella Objectives Describe the general structure, biochemical, Antigenic structures and diagnostic criteria of Brucella. Illustrate the pathogenesis.

Lecturer: Bahiya Osrah Background PCR (Polymerase Chain Reaction) is a molecular biological technique that is used to amplify specific.

Invasive Enteritis and systemic infections: Four clinical syndromes, plus the carrier state, are associated with the genus Salmonella. 1-Gastroenteritis.

I. PCR- Polymerase Chain Reaction A. A method to amplify a specific piece of DNA. DNA polymerase adds complementary strand DNA heated to separate strands.

Polymerase Chain Reaction (PCR). DNA DNA is a nucleic acid that is composed of two complementary nucleotide building block chains. The nucleotides are.

Section 4 Lesson 3– PCR. PCR – The Polymerase Chain Reaction PCR is a technique used to amplify specific sequences of DNA. This technique can be used.

Presented by: Khadija Balubaid.  PCR (Polymerase Chain Reaction) is a molecular biological technique  used to amplify specific fragment of DNA in vitro.

Identification and differentiation of Brucella melitensis and Brucella abortus strains isolated in Greece, directly from solid tissues by MULTIPLEX and.

Polymerase Chain Reaction (PCR)

Bharathy.S., L.Gunaseelan., K.Prabu

PCR conditions: 94ºC for 15 min

RAW MILK CONSUMPTION : A CAUSE FOR CROHN'S DISEASE ????

Polymerase Chain Reaction (PCR)

Prof JAMAL R Al-RAWI-MBChB, MSc, FICMS-2012

Polymerase Chain Reaction

DNA profiling DNA profiling is a technique by which individuals can be identified and compared via their respective DNA profiles. Definitions you will.

BIOTECHNOLOGY BIOTECHNOLOGY: Use of living systems and organisms to develop or make useful products GENETIC ENGINEERING: Process of manipulating genes.

PCR How does PCR work?: Separation of two strands

How are areas of DNA that don’t code for proteins (genes) used by our cells? How can we make use of these areas?

PCR -PCR replicates (or amplifies) the DNA many times so that a large enough sample can be analyzed.

The Polymerase Chain Reaction (PCR): Replicating DNA in the Test Tube

Molecular Biology lecture -Putnoky

Mustansiriyah University College of science Biology Dept

Introduction to Polymerase Chain Reaction (PCR)

Dr. Israa ayoub alwan Lec -12-

High-resolution capillary gel electrophoresis of the B

Table 1. Diagnostic methods for systemic fungal infection (n=70)

Presentation transcript:

بسم الله الرحمن الرحيم (وإن لكم في الأنعام لعبرة نسقيكم مما في بطونه ، من بين فرث ودم لبناً خالصاً سائغاً للشاربين ) سورة النحل آيه (66)

Brucella spp. Brucella spp.( Coccobacilli )

 Drinking Un- pasteurized camel, sheep, goat or cattle Milk  Contact with Infected Animals

Surgeon David Bruce;1887 Micrococcus melitensis

Gram Negative coccobacilli Culture on Chocolate agar Microbiological Characteristics of Brucella spp

Portals of Entry

Fever, headache Sore throat Joint Pain Muscle Aches Ear Aches Fatigue Anorexia

1 Clinical 2 Blood Cultures 3 Serology 4 PCR

To compare 3 of the reported PCR techniques for Diagnosis of Brucellosis from Human blood and determine the most suitable technique for a Clinical Microbiology Lab in terms of Sensitivity, Specificity, Robustness and Ease of Implementation

Material 147 random samples from Brucellosis patients 50 control samplesQuestionnaire Brucella melitensis

Methods 3 PCR techniques using genus specific primers ElectrophoresisLimit of Detection DNA extraction

Primers (B 4 and B 5 ) Brucella abortus 223bp fragment B 4 =5 TGGCTCGGTTGCCAATATCAA3' B 5 =5' CGCGCTTGCCTTTCAGGTCTG-3' StepTempTime 1Initial Denaturation93 o C5 min 2Template Denaturation90 o C60 Sec 3Primer Annealing60 o C60 Sec 4Primer Extension72 o C60 Sec 5Final Extension72 o C7 min Cycling Profile Repeated 35 times

Primers (JPF and JPR) Brucella abortus encoding 193bp ) JPF=5' GCGCTCAGGCTGCCGACGCAA-3' JPR=5' ACCAGCCATTGCGGTCGGTA-3' StepTempTime 1Initial Denaturation94 o C4 min 2Template Denaturation94 o C60 Sec 3Primer Annealing60 o C60 Sec 4Primer Extension72 o C60 Sec 5Final Extension72 o C3 min Repeated 35 cycles Cycling Profile

Primers (F 4 and R 2 ) Brucella abortus 905bp fragment. (Romero et al.,1995 ). F4 = 5'TCGAGCGCCCGCAAAGGG-3' R 2 = 5'AACCATAGTGTCTCCACTAA-3' Cycling Profile StepTempTime 1Initial Denaturation95 o C5 min 2Template Denaturation95 o C30 Sec 3Primer Annealing54 o C90 Sec 4Primer Extension72 o C90 Sec 5Final Extension72 o C6 min Repeated 30 cycles

(PCR Work Station - Plas Labs)

(MyCycler - Bio Rad)

STEPS INVOLVED Taq Polymerase Forward Primer Reverse Primer

P =0.05 Age Distribution of Brucella species Less than 25 ys25 to < 50 ysMore than 50 ys

Fever Anorexia Headache Vomiting Fatigue P=0.001 Symptoms of Brucellosis in the study population Body aches

Smudged bands DNA Extraction

M

Modifications

StepTempTime 1Initial Denaturation93 o C5 min 2Template Denaturation90 o C60 Sec 3Primer Annealing60 o C60 Sec 4Primer Extension72 o C60 Sec 5Final Extension72 o C7 min Repeated 40 times تكرر 40

Repeated 40 times StepTempTime 1Initial Denaturation94 o C4 min 2Template Denaturation94 o C60 Sec 3Primer Annealing60 o C60 Sec 4Primer Extension72 o C60 Sec 5Final Extension72 o C3 min تكرر 40

Repeated 35 times StepTempTime 1Initial Denaturation95 o C5 min 2Template Denaturation95 o C30 Sec 3Primer Annealing54 o C90 Sec 4Primer Extension72 o C90 Sec 5Final Extension72 o C6 min تكرر (35) تكرر 35

7x 10 2 cfu/ml

7 x 10 5 cfu/ml

7 x 10 7 cfu/ml

144 (98.0)* 130 (88.4)* 78 (53.1) * 69(147) 17 (147) 3 (147) (100) 50 P= Results obtained using the 3 sets of primers

P = 0.05 Senitivity and Specificity of the 3 sets of primers

Egyptian Journal of Medical Microbiology, 2007

Canadian Journal of Microbiology, 2008

Thank you