Current Sequencing Effort of Tomato Chromosome 2 Sunghwan Jo, KRIBB.

Slides:

Advertisements

Similar presentations

1 Radio Maria World. 2 Postazioni Transmitter locations.

Advertisements

The Fall Messier Marathon Guide

EcoTherm Plus WGB-K 20 E 4,5 – 20 kW.

Trend for Precision Soil Testing % Zone or Grid Samples Tested compared to Total Samples.

Trend for Precision Soil Testing % Zone or Grid Samples Tested compared to Total Samples.

AGVISE Laboratories %Zone or Grid Samples – Northwood laboratory

Trend for Precision Soil Testing % Zone or Grid Samples Tested compared to Total Samples.

SKELETAL QUIZ 3.

Fill in missing numbers or operations

Name: Date: Read temperatures on a thermometer Independent / Some adult support / A lot of adult support

Reflection nurulquran.com.

EuroCondens SGB E.

Slide 1Fig 26-CO, p.795. Slide 2Fig 26-1, p.796 Slide 3Fig 26-2, p.797.

Ozone Level ppb (parts per billion)

Addition and Subtraction Equations

Multiplication X 1 1 x 1 = 1 2 x 1 = 2 3 x 1 = 3 4 x 1 = 4 5 x 1 = 5 6 x 1 = 6 7 x 1 = 7 8 x 1 = 8 9 x 1 = 9 10 x 1 = x 1 = x 1 = 12 X 2 1.

Division ÷ 1 1 ÷ 1 = 1 2 ÷ 1 = 2 3 ÷ 1 = 3 4 ÷ 1 = 4 5 ÷ 1 = 5 6 ÷ 1 = 6 7 ÷ 1 = 7 8 ÷ 1 = 8 9 ÷ 1 = 9 10 ÷ 1 = ÷ 1 = ÷ 1 = 12 ÷ 2 2 ÷ 2 =

1 When you see… Find the zeros You think…. 2 To find the zeros...

Add Governors Discretionary (1G) Grants Chapter 6.

CHAPTER 18 The Ankle and Lower Leg

Summative Math Test Algebra (28%) Geometry (29%)

ASCII stands for American Standard Code for Information Interchange

Who Wants To Be A Millionaire?

£1 Million £500,000 £250,000 £125,000 £64,000 £32,000 £16,000 £8,000 £4,000 £2,000 £1,000 £500 £300 £200 £100 Welcome.

The 5S numbers game..

突破信息检索壁垒－SciFinder Scholar 介绍

A Fractional Order (Proportional and Derivative) Motion Controller Design for A Class of Second-order Systems Center for Self-Organizing Intelligent.

Training Objective: students will be able to evaluate expressions using the order of operations.

The basics for simulations

A sample problem. The cash in bank account for J. B. Lindsay Co. at May 31 of the current year indicated a balance of $14, after both the cash receipts.

Look at This PowerPoint for help on you times tables

2013 Fox Park Adopt-A-Hydrant Fund Raising & Beautification Campaign Now is your chance to take part in an effort to beautify our neighborhood by painting.

Regression with Panel Data

TCCI Barometer March “Establishing a reliable tool for monitoring the financial, business and social activity in the Prefecture of Thessaloniki”

TCCI Barometer March “Establishing a reliable tool for monitoring the financial, business and social activity in the Prefecture of Thessaloniki”

Progressive Aerobic Cardiovascular Endurance Run

Biology 2 Plant Kingdom Identification Test Review.

Visual Highway Data Select a highway below... NORTH SOUTH Salisbury Southern Maryland Eastern Shore.

Shade the rectangles with correct answer with a colour pencil of your choice.

MaK_Full ahead loaded 1 Alarm Page Directory (F11)

Midterm Review Part II Midterm Review Part II 40.

2011 WINNISQUAM COMMUNITY SURVEY YOUTH RISK BEHAVIOR GRADES 9-12 STUDENTS=1021.

Before Between After.

Benjamin Banneker Charter Academy of Technology Making AYP Benjamin Banneker Charter Academy of Technology Making AYP.

2011 FRANKLIN COMMUNITY SURVEY YOUTH RISK BEHAVIOR GRADES 9-12 STUDENTS=332.

2.10% more children born Die 0.2 years sooner Spend 95.53% less money on health care No class divide 60.84% less electricity 84.40% less oil.

Foundation Stage Results CLL (6 or above) 79% 73.5%79.4%86.5% M (6 or above) 91%99%97%99% PSE (6 or above) 96%84%100%91.2%97.3% CLL.

Subtraction: Adding UP

ADDING UP. CATEGORY 1 Adding Up strategy : The whole number is a multiple of ten or one hundred. The subtrahend is close to a multiple of ten or a landmark.

Numeracy Resources for KS2

1 Non Deterministic Automata. 2 Alphabet = Nondeterministic Finite Accepter (NFA)

Static Equilibrium; Elasticity and Fracture

ANALYTICAL GEOMETRY ONE MARK QUESTIONS PREPARED BY:

Resistência dos Materiais, 5ª ed.

& dding ubtracting ractions.

Lial/Hungerford/Holcomb/Mullins: Mathematics with Applications 11e Finite Mathematics with Applications 11e Copyright ©2015 Pearson Education, Inc. All.

Doc.: IEEE /0333r2 Submission July 2014 TGaj Editor Report for CC12 Jiamin Chen, HuaweiSlide 1 Date: Author:

1 Non Deterministic Automata. 2 Alphabet = Nondeterministic Finite Accepter (NFA)

What impact does the address have on the tribe?

Graeme Henchel Multiples Graeme Henchel

úkol = A 77 B 72 C 67 D = A 77 B 72 C 67 D 79.

Schutzvermerk nach DIN 34 beachten 05/04/15 Seite 1 Training EPAM and CANopen Basic Solution: Password * * Level 1 Level 2 * Level 3 Password2 IP-Adr.

Presentation transcript:

Current Sequencing Effort of Tomato Chromosome 2 Sunghwan Jo, KRIBB

Identical segment duplication/ Chimera BAC clone? What is best way to speed up sequencing progress? Increase seed BACs!?

Redundant sequence in chromosome 2

Mbo108P14 (34290bp) HBa323A cM (128329bp) Hba059M17, 67cM (115036bp) 65331bp bp bp 26007bp 9.1kb 25.2kb Mbo008E03 71cM (46,886bp) HBa204D01 73cM (179,870bp) 1 1 ~28Kb Case 1 4.9kb

(RC) M108P14 H323A14 M108P14-confirm (455bp) M108P14H323A14 M108P14 -confirm (455bp) CATTTTATGCTGGCGAAACC LEFT PRIMER ACCCTTCCTCTTGCATCCTT RIGHT PRIMER M82 Mbo108P14 (34,290bp) HBa323A14 (128,329bp) 65,331bp 1 40,147bp 1 9.1kb 25.2kb 34,290

H323A14-M108P14-confirm (462bp) TGTCCGAGTGGATCTCCTTC LEFT PRIMER CATTTTATGCTGGCGAAACC RIGHT PRIMER H323A14-M108P14-confirm (462bp) M108P14H323A14M82H059M17 Mbo108P14 (34,290bp) HBa323A cM (128,329bp) H059M17, 67cM (115,036bp) 65331bp bp bp 26007bp 9.1kb25.2kb 4.9kb

Mbo108P14 (34,290bp) HBa323A cM (128,329bp) H059M17, 67cM (115,036bp) 65,331bp 1 40,147bp 1 16,907bp26,007bp 9.1kb25.2kb 4.9kb H059M17-confirm (421bp) GTGGTGGGATCAACCTGTCT LEFT PRIMER TGCATGGCAATTTTGTATCC RIGHT PRIMER H059M17-confirm (421bp) M108P14M82H059M17

No segmental duplication but chimera clone Mbo108P14 (34,290bp) HBa323A cM (128,329bp) H059M17, 67cM (115,036bp) 65,331bp 1 40,147bp 1 16,907bp26,007bp 9.1kb25.2kb 4.9kb

E D01 G No segmental duplication but chimera clone Case 2 Mbo008E03 71cM (46,886bp) HBa204D01 73cM (179,870bp) 1 1 ~28Kb

Hba75D08_sp6 (74.8cM) Mbo049G16_sp6 (75.0cM) T0702 (76.0cM) H044O16_sp6 (75.1cM) MboI73G04_T7 (75.3cM) 2-I 2-H 2-I Tomato-EXPEN 2000 IL map BAC contig Case 3

H075D08 or Hba75D08_sp6 (74.8cM) Contig 1 Contig 2 Contig 3 All contigs are well assembled!!

Contig 1 H075D08 H044O16 Contig 3

H075D08 Contig 1 Contig 2

H075D08 H044O16 H075D08 H075D08- H044O16 -confirm (397bp) H044O16 confirm (427bp) GGCCGTTCAACTTGCTCTTA LEFT PRIMER GGCACAAACATGTCAAATGC RIGHT PRIMER GGCCGTTCAACTTGCTCTTA LEFT PRIMER CTGAATTCGCGAACCAATCT RIGHT PRIMER

Hba0075D08 (74.8cM) Mbo0049G16 (75.0cM) T0702 (76.0cM) Hba044O16 (75.1cM) MboI73G04 (75.3cM) M020N15 TO-M073G04 Hba0044O Hba0075D08 H165K22 TO-H228I09 Mbo0049G16 M021D D08 44O16 G 75D08 49G16 G

Contig 1 H075D08 H044O16 Contig 3

TG426 TG48 TG147 TG426 (89.3cM) TG48 (92cM) TG147 (96cM) H011A02 TG373 (94cM) Case 4 80kb

H125L12 (12,174bp) 1bp E011K05 (91,579bp) 671bp6,462bp 5,798bp H125L12 (12,174bp) T0493 (48.0 cM) Expect 11,466bp E011K05 (91,579bp) H125L12 E011K05 Sequence result Dot-Matrix result Two sequence alignment result 2_G Case 5

Summary NameGenomeEnzyme siteNameGenomeEnzyme site Mbo108P14XOHBa075D08XX Mbo008E03XOMbo049G16OX HBa323A14OXHBa044O16XX HBa059M17OX

Probably, chimeric BAC clones Were selected as “Next BAC “ clones during extension process 1.Chimeric BAC clone itself exist in libraries but not in genome. 2. Not all strange BAC clones have enzyme site.

What is best way to speed up sequencing progress? Increase seed BAC 64 Seed BACs 74 Extended BACs 28 contigs 16 single BAC + increase extending chance - Increase overlap length

Seed BACsBAC extensionTotal reading length Non- overlapped reading length ,016k b 10,888kb ContigsingleAverage overlap % done (22Mb) kb49.5% BAC Sequencing Summary

Difference between the order of Genetic marker and sequence result cosII Increase overlap length or lost BAC sequence