MLH1 c.1852_1853delinsGC (aka c.1852_1853AA>GC, Lys618Ala)  Leeds – found in 4 out of ~400 patients  DMuDB – entered Birmingham (x6), Leeds (x1), Dundee.

Slides:

Advertisements

Similar presentations

Colon Cancer The life time risk of developing Colon Cancer in the United States in one in sixteen. This means 144,000 new cases a year accounting for.

Advertisements

This short questionnaire will help to determine whether there may be a gene in your family connected to an increased risk of the development of bowel.

A review of the Wilson disease service over the past 15 years Miranda Durkie Sheffield Diagnostic Genetics Service

Could distal MSH2 upstream deletions cause HNPCC? … another cancer susceptibility factor. John Taylor CMGS Spring Conference 2009.

Familial Hypercholesterolaemia

CMGS LS FAP MAP Training Day, 30/11/2009 Colorectal Cancer BP Training Day Ian M Frayling Consultant Genetic Pathologist Director, Laboratory Genetics.

Familial adenomatous polyposis

Hereditary GI Cancer-a Primer for Medical Oncologists

HNPCC Case report Referral Bowel Cancer aged 49 and a possible family History of HNPCC.

Clinical background: Patient RM, YoB 1966 Her family were originally referred because of a history of breast and ovarian cancer. BRCA testing found a missense.

Universal Screening for Lynch Syndrome

Hereditary GI Cancer Syndromes: Keys to identify high risk patients

Molecular Path of the GI tract Dr Shaun Walsh. Mutation analysis in Tumours A new challenge for oncologists, surgeons pathologists and for patients I’m.

Suggestions for PMS2 best practice Jenny Simmonds

Identification of X-linked mental retardation genes Cat Yearwood St. George’s, London.

HNPCC and FAP are both associated with familial colon cancer but differ in many aspects. Describe the similarities and differences between these conditions.

Lynch Syndrome and Colorectal Cancer Steven G. Proshan, M.D. Annapolis Colon and Rectal Surgeons Anne Arundel Medical Center November 8,

Risk Assessment for HNPCC

A few thoughts on cancer and cancer family syndromes Pamela McGrann, MD. Department of Medical Genetics.

COLORECTAL BLEEDING: a multidisciplinary approach Torino, 31 marzo-1 aprile 2006 GENETIC EVALUATION Schena M, Angelini F, Bertetto O. Department of Medical.

Lecture 22 Cancer Genetics II: Inherited Susceptibility to Cancer Stephen B. Gruber, MD, PhD November 19, 2002.

Mechanisms and Epidemiology of Colon Cancer

Breast Cancer Risk and Risk Assessment Models

About these slides SPEC – Short Presentation in Emerging Concepts

Familial Colorectal Cancers Francis M. Giardiello, M.D. The Johns Hopkins University.

Cancer Genetics Diane Stirling McMillan Nurse Specialist in Genetics

Comprehensive IHC Screening for Lynch Syndrome: What You Need to Know Andrea Lewis, MS, CGC January 14, 2010.

HENRY T. LYNCH, MD JANE F. LYNCH, BSN Creighton University

MSH2 and Human Nonpolyposis Colon Cancer Yael Aschner.

Diagnostic testing II. Previously…. Guidelines for evaluating tests have been discussed – Population spectrum – Reference standard Verification bias –

Cancer Genetics for Primary Care Sara Levene Registered Genetic Counsellor.

Chris Campbell West Midlands Regional Genetics laboratory

Genetics & Colorectal Cancer

Genetics of Colorectal Cancer

Novel splice-site mutations as the cause of FAP-related cancer in two families K Sweet, B McIlhatton, V McConnell, W Logan and C Graham Regional Molecular.

Tumour Analysis-Lynch Syndrome Dr Alan Donaldson Consultant in Clinical Genetics Bristol.

Familial Risk and Surveillance of Colon and Rectum Malcolm Dunlop Academic Coloproctology & Colon Cancer Genetics Group University of Edinburgh & Western.

Apparent homozygous deletion identified in Alström syndrome patient Elizabeth Perrott West Midlands Regional Genetics Laboratory.

What are Microsatellites? D2S123 TAGGCCACACACACACACACA Unique Primer Mono, di, tri, tetra nucleotide repeats HNPCC - Expansion/contraction of nl repeats.

Bonny Blackard Biology 169 April 4, 2006

Uterine Cancer Endometrial (or uterine) cancer will account for 50,000 new cases and 8200 deaths in the United States in Two genetic disorders are.

Slides last updated: March 2015 CRC: RISK FACTORS.

1 LYNCH SYNDROME EPCAM FAMILY WITH PREDOMINANT COLORECTAL CANCER HENRY T. LYNCH, MD; STEPHEN N. THIBODEAU, PHD; CARRIE SNYDER, MSN, RN, APNG; JENNIFER.

Javad Jamshidi Fasa University of Medical Sciences, December 2015 Cancer Genetics Session 4 Medical Genetics.

Collaborative Study Proposal: Renal Cell Cancer in Lynch Syndrome.

How do we interpret the variants?. Overview How do we prioritize the filtered variants? What filters can be used to identify the causative variants? What.

Date of download: 5/31/2016 From: The Hereditary Nonpolyposis Colorectal Cancer Syndrome: Genetics and Clinical Implications[dhelix] Ann Intern Med. 2003;138(7):

Robert E. Schoen, MD MPH Associate Professor of Medicine and Epidemiology Division of Gastroenterology University of Pittsburgh Hereditary Colorectal Cancer:

Lynch Syndrome or Hereditary Non-Polyposis Colorectal Cancer (HNPCC)

Patient #1 Patient #2 Patient #3 Normal Lung

Frances Bond West Midlands Regional Genetics Laboratory 12/04/10

What are Microsatellites?

Epidermolysis Bullosa: Novel and De Novo Premature Termination Codon and Deletion Mutations in the Plectin Gene Predict Late-Onset Muscular Dystrophy

Extensive but hemiallelic methylation of the hMLH1 promoter region in early-onset sporadic colon cancers with microsatellite instability Yasuyuki Miyakura,

Volume 74, Issue 11, Pages (December 2008)

Lynch syndrome (LS) Hereditary Non-polyposis Colorectal Cancer (HNPCC)

Ajay Goel, Takeshi Nagasaka, Jennifer Spiegel, Richard Meyer, Warren E

Noralane M Lindor Clinical Gastroenterology and Hepatology

DiagMMR™ assay validation sample collection

Molecular Cytogenetic Evidence for a Common Breakpoint in the Largest Inverted Duplications of Chromosome 15 A.E. Wandstrat, J. Leana-Cox, L. Jenkins,

Epidermolysis Bullosa: Novel and De Novo Premature Termination Codon and Deletion Mutations in the Plectin Gene Predict Late-Onset Muscular Dystrophy

Analysis of Rare APC Variants at the mRNA Level

Germline Epigenetic Silencing of the Tumor Suppressor Gene PTPRJ in Early-Onset Familial Colorectal Cancer Ramprasath Venkatachalam Gastroenterology

Detection of gene recombination in endoxifen- or Adeno-Cre-induced tumours. Detection of gene recombination in endoxifen- or Adeno-Cre-induced tumours.

Cerebral Cavernomas in a Family with Multiple Cutaneous and Uterine Leiomyomas Associated with a New Mutation in the Fumarate Hydratase Gene Elena Campione,

Kit-Sing Au, Adelaide A. Hebert, E. Steve Roach, Hope Northrup

SAF-1 expression in clinical breast cancer tissues.

A, Proportion of variants detected in the MMR genes.

Gene copy number analysis by multiplexed quantitative differential PCR for BRCA1 and BRCA2 for 23 DNA specimens obtained from patients of Hispanic ancestry.

Individuals affected with cancer included in the Lynch syndrome are colored. Individuals affected with cancer included in the Lynch syndrome are colored.

Presentation transcript:

MLH1 c.1852_1853delinsGC (aka c.1852_1853AA>GC, Lys618Ala)  Leeds – found in 4 out of ~400 patients  DMuDB – entered Birmingham (x6), Leeds (x1), Dundee (x4) – unclassified  Newcastle consider it non-pathogenic  ~50 entries in InSIGHT (LOVD) database  ~40 entries in New Foundland MMR database  Described at least once in literature (and once in correspondence with IF) in trans with a truncating mutation in non-Turcot/mismatch repair cancer syndrome associated with bi-allelic loss  Some evidence that Lys618Ala reduces MLH1/PMS2 dimerisation by a large degree (Guerrette et al 1999, PMID )  Yeast functional studies (various methods; DME, 2-hybrid) maintain MMR, sometimes at a sub-normal level (Takahashi at al 2007, Kondo et al 2003, PMIDs & )  Large population study found it at a higher % in healthy individuals than in CRC (familial & sporadic; Christensen et al 2008 PMID )  Consensus? INCLUDE CMGS POLICY IN BP GUIDELINES?

Duplications; how do we report them?  Patient: Ca uterus & melanoma. FH uterine, bladder & colon Ca.  Patient & affected sister (Ca uterus) duplication of MSH2 ex1-6 by MLPA (confirmed by 2 nd kit); no further muts in MLH1, MSH2, MSH6.  Endometrial carcinoma – MSI-H & loss of MSH2 & MSH6 on IHC (poor staining for MSH6 on normal control tissue).  Possible production of functional transcriptional element?

Duplications; how do we report them?  Triplication/homozygous duplication  Patient: Ca 30, Amsterdam +ve on maternal side, no known FH on paternal side (father died 60).  4 copies of MLH1 ex5-8 detected – apparently at least 2 of which are contiguous (ascertained by using exon 8F and exon 5R primers & long PCR); possibility of 3 contiguous copies on one allele  Not apparently MMRCS/Turcot syndrome-type clinical picture, despite early onset of CRC.  Found nothing similar in literature – any ideas/shared experience?  Should/will there be something in the BPG regarding MMRCS?