Mutations.

Slides:

Advertisements

Similar presentations

KEY CONCEPT Mutations are changes in DNA that may or may not affect observable traits/characteristics.

Advertisements

Defined: any change in an organism’s DNA Where: Single genes or entire chromosomes – Some gene mutations change phenotype (physical characteristics)

Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

Defined: a change in an organism’s DNA Where: DNA or Chromosomes When: During replication, Synapses, or Crossing-Over Mutations can affect a single.

Mutations are changes in DNA that may or may not affect phenotype.

1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.

8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.

12-4 Mutations Mutation: A Change in DNA Mutation – any change in the DNA sequence that can also change the protein it codes for Mutations in Reproductive.

MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.

Mutations Chapter 12.4.

Genetic Changes 11.3.

Genetic Mutations Increasing Genetic Diversity May 4, 2010.

Ch Mutations Section Objectives:

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads!... What do we have?

Chapter 11.6 Mutations. Definition- Mutation- a change in the DNA nucleotide sequence Mutation- a change in the DNA nucleotide sequence Types of mutations:

  Understand what mutations are  Understand how they occur  Analyze the different types of mutations  Understand how mutations affect amino acid.

Introduction A mutation is a change in the normal DNA sequence. They are usually neutral, having no effect on the fitness of the organism. Sometimes,

Genetic Disorders Genetic Mutations Because DNA controls characteristics of a cell it must be copied before a cell reproduces Sometimes mistakes occur.

DNA Mutations. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC.

DNA (Gene) Mutations. What is a gene mutation? Often times, parts of DNA will have a base (or more) missing, added, or incorrect.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.

MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

Mistakes can occur in any process. When do mistakes have stronger effects – When making a DNA? Making mRNA? Making a protein? Explain why. (Same as saying.

Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.

12.4 Mutations Copyright Pearson Prentice Hall.. What Are Mutations? Changes in the nucleotide sequence of DNA (genetic material) May occur in somatic.

L. COLEMAN GENE: the section of a DNA molecule that contains the recipe for one protein. NOTE: Each DNA molecule with it’s supporting structures.

1.Most genetic disorders result from a mutation in one gene. a.Mutation: a change in an organism’s genetic material (DNA) 2.A mutated gene produces a.

13.3 Mutations. POINT > Define a gene in simple terms POINT > Define and describe genetic mutations POINT > Distinguish between gene and chromosomal mutations.

Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.

Reality Science Fiction! Just silly.. 1. Some mutations affect a single gene, while others affect an entire chromosome. 2. A mutation is a change in an.

8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.  May occur in somatic cells (aren‘t passed to offspring)

Mutations and Genetic Disorders. Review One Wrong Letter Questions to think about: 1) How is the little boy in the video.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcriptiontranslation.

Section 11.3: Genetic Changes

Genetics Lesson 4 Mutations.

11.3 Mutations.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Mermaid Syndrome Video.

Copyright Pearson Prentice Hall

What happens when things go wrong?

DNA Mutations & Technology

Mutations LN #23 Ms. Garcia California Content Standard Genetics

11.3 Section Objectives – page 296

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads! What do we.

Chapter 11.6 When it all goes Wrong

4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.

A mutation is a change in an organism’s DNA.

Mechanisms for the Diversity of Life

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

13.3 Mutations.

11.3 Section Objectives – page 296

DNA (Gene) Mutations.

Mutations: Changes in Genes

Presentation transcript:

Mutations

Step 9: Mutation bookwork Mutations occur when exposure to certain chemicals (called mutagens), radiation (such as UV light from the sun), or mistakes in DNA replication change the DNA sequence in a cell. Changes in the DNA sequence are usually repaired by the cell, but sometimes they don’t get fixed and are passed on when the cell divides. However, mutations can have dramatic effects (both helpful and harmful) for the organism!

These mutations happen all the time, but most mutations don’t actually affect the organism for several reasons: Most DNA doesn’t even code for anything. Many different codons will code for the same amino acid, so sometimes the protein is unchanged Even though each cell has all of the genes for every protein used in the entire body, most cells don’t even make all of those different proteins. Even if one cell is mutated, it’s only one out of trillions of cells in the body. Mutations will only be passed on to the baby if they occur in the germ cells (which become sperm and eggs)

Map of the world by natural skin color (The evolution of racism)

CANCER!!!