FROM KIM FOGLIA http://www. explorebiology

RFLPs Restriction Fragment Length Polymorphism FROM KIM FOGLIA http://www.explorebiology.com/pptAP/2008/BIOTECHNOLOGY/ RFLPs Restriction Fragment Length Polymorphism differences in DNA between individuals Alec Jeffries 1984 change in DNA sequence affects restriction enzyme “cut” site creates different fragment sizes & different band pattern

Differences at the DNA level FROM KIM FOGLIA http://www.explorebiology.com/pptAP/2008/BIOTECHNOLOGY/ Differences at the DNA level Why is each person’s DNA pattern different? sections of “junk” DNA doesn’t code for proteins made up of repeated patterns CAT, GCC, and others each person may have different number of repeats many sites on our 23 chromosomes with different repeat patterns GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA GCTTGTAACGGCATCATCATCATCATCATCCGGCCTACGCTT CGAACATTGCCGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA

Comparing cut up DNA How do we compare DNA fragments? FROM KIM FOGLIA http://www.explorebiology.com/pptAP/2008/BIOTECHNOLOGY/ Comparing cut up DNA How do we compare DNA fragments? separate fragments by size How do we separate DNA fragments? run it through a gelatin agarose made from algae gel electrophoresis

Gel electrophoresis – + FROM KIM FOGLIA http://www.explorebiology.com/pptAP/2008/BIOTECHNOLOGY/ Gel electrophoresis A method of separating DNA in a gelatin-like material using an electrical field DNA is negatively charged when it’s in an electrical field it moves toward the positive side DNA         – + “swimming through Jello”

Gel electrophoresis – + DNA moves in an electrical field… FROM KIM FOGLIA http://www.explorebiology.com/pptAP/2008/BIOTECHNOLOGY/ Gel electrophoresis DNA moves in an electrical field… so how does that help you compare DNA fragments? size of DNA fragment affects how far it travels small pieces travel farther large pieces travel slower & lag behind DNA        – + “swimming through Jello”

Running a gel 1 2 3 fragments of DNA separate out based on size FROM KIM FOGLIA http://www.explorebiology.com/pptAP/2008/BIOTECHNOLOGY/ Running a gel fragments of DNA separate out based on size cut DNA with restriction enzymes 1 2 3 Stain DNA ethidium bromide binds to DNA fluoresces under UV light

Uses: Forensics Comparing DNA sample from crime scene with suspects & victim suspects crime scene sample S1 S2 S3 V – DNA  +

FROM KIM FOGLIA http://www. explorebiology DNA fingerprints Comparing blood samples on defendant’s clothing to determine if it belongs to victim DNA fingerprinting comparing DNA banding pattern between different individuals ~unique patterns

RFLP / electrophoresis use in forensics FROM KIM FOGLIA http://www.explorebiology.com/pptAP/2008/BIOTECHNOLOGY/ RFLP / electrophoresis use in forensics 1st case successfully using DNA evidence 1987 rape case convicting Tommie Lee Andrews “standard” semen sample from rapist blood sample from suspect “standard” How can you compare DNA from blood & from semen? RBC? “standard” semen sample from rapist blood sample from suspect “standard”

Electrophoresis use in forensics FROM KIM FOGLIA http://www.explorebiology.com/pptAP/2008/BIOTECHNOLOGY/ Electrophoresis use in forensics Evidence from murder trial Do you think suspect is guilty? blood sample 1 from crime scene blood sample 2 from crime scene blood sample 3 from crime scene “standard” blood sample from suspect OJ Simpson blood sample from victim 1 N Brown blood sample from victim 2 R Goldman “standard”

Uses: Evolutionary relationships FROM KIM FOGLIA http://www.explorebiology.com/pptAP/2008/BIOTECHNOLOGY/ Uses: Evolutionary relationships Comparing DNA samples from different organisms to measure evolutionary relationships turtle snake rat squirrel fruitfly – 1 3 2 4 5 1 2 3 4 5 DNA  +

Uses: Medical diagnostic Comparing normal allele to disease allele chromosome with normal allele 1 chromosome with disease-causing allele 2 allele 1 allele 2 – DNA  Example: test for Huntington’s disease +

Uses: Paternity Who’s the father? – Mom F1 F2 child DNA  +

LAY OUT 3 YARN PIECES ON YOUR DESK DON’T STRETCH LAY OUT 3 YARN PIECES ON YOUR DESK DON’T STRETCH ! TRIM ALL YOUR YARN PIECES SO THEY ARE THE SAME LENGTH- 50 cm Image from : http://thecreativeimperative.blogspot.com/2011/06/american-flag-wreath-sort-of.html

RESTRICTION ENDONUCLEASES GEL #1 Use the EcoRI restriction enzyme provided to: Individual #1 (TAN yarn) - Cuts at 8 cm AND 22 cm Individual #2 (PURPLE yarn) - Cuts at 10 cm AND 32 cm Individual #3 (GREEN yarn)- Cuts at 10 cm AND 15 cm AND 40 cm

SET UP YOUR DESKTOP AS A GEL Use sticky notes to LABEL THE + and – poles Use sticky notes to LABEL your lanes Load your “gel” with your “DNA” that has been cut with “restriction enzymes” Complete RFLP analysis and draw a picture of the results in your BILL #1 TAN #2 PURPLE #3 GREEN – DNA  +

RESTRICTION ENDONUCLEASES GEL #2: Use DIFFERENT “restriction enzymes” to cut the SAME DNA Cut one piece of yarn with EcoRI –Cuts at 8 cm AND 22 cm Cut one piece of yarn with HindIII– Cuts at 18 cm AND 35 cm Cut one piece of yarn with BOTH EcoRI AND HindIII

SET UP YOUR DESKTOP AS A GEL EcoRI + HindIII Use sticky notes to LABEL THE + and – poles Use sticky notes to LABEL your lanes Load your “gel” with your “DNA” that has been cut with “restriction enzymes” Complete RFLP analysis and draw a picture of the results in your BILL EcoRI HindIII – DNA  +

EXPLAIN WHY DNA moves in an electric field toward the POSITIVE pole EXPLAIN WHY DNA moves in an electric field toward the POSITIVE pole. EXPLAIN the relationship between FRAGMENT SIZE and DISTANCE MOVED on a gel.

Linus Pauling used RFLP analysis to show that the sickle cell mutation caused a change in the DNA code. He cut the gene from a person with normal hemoglobin and a person with sickle cell anemia with a restriction enzyme and compared them using RFLP analysis. Use what you know about the sickle cell mutation and restriction recognition sites to EXPLAIN how a mutation could change the NUMBER and LENGTHS OF FRAGMENTS on a gel . SP 6: The student can work with scientific explanations and theories. 6.2 The student can construct explanations of phenomena based on evidence produced through scientific practices

http://image. slidesharecdn http://image.slidesharecdn.com/4-140318210158-phpapp01/95/biotechnology-4-61-638.jpg?cb=1395195168

http://image. slidesharecdn http://image.slidesharecdn.com/4-140318210158-phpapp01/95/biotechnology-4-61-638.jpg?cb=1395195168 MAKE A PREDICTION about what the gel pattern from a person who is heterozygous for the sickle cell allele might look like. HINT: Think about what the word HETEROZYGOUS means. SP 6: The student can work with scientific explanations and theories. 6.1 The student can make claims and predictions about natural phenomena based on scientific theories and models.

Give at least FOUR (4) EXAMPLES of how DNA ANALYSIS can be used to compare DNA.