Phylogenetic analysis and amino acid sequences comparison of HO endonucleases. Phylogenetic analysis and amino acid sequences comparison of HO endonucleases.

Slides:

Advertisements

Similar presentations

Molecular Evolution Revised 29/12/06

Advertisements

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

Multiple Sequence Alignment May 12, 2009 Announcements Quiz #2 return (average 30) Hand in homework #7 Learning objectives-Understand ClustalW Homework#8-Due.

Bioinformatics 2011 Molecular Evolution Revised 29/12/06.

Calculating branch lengths from distances. ABC A B C----- a b c.

I Ia II Ib I IaIb IIIII IV V VI Figure S1. Comparison of amino acid sequence of O. sativa (Os) SUV3 (1-579) with SUV3 from A. thaliana (At) (1-571), H.

A B C D E F G H I J K FigS1. Supplemental Figure S1. Evolutionary relationships of Arabidopsis and tomato Aux/IAA proteins. The evolutionary history was.

Introduction to Bioinformatics Resources for DNA Barcoding

WRKY transcription factors in potato genome factors in potato genome

Julián Mateus1 • Stef de Haan2 Carlos Chuquillanqui2

Figure 1. Structure of the fly LGR2 gene and the corresponding cDNA sequence. A, Derivation of the fly LGR2 full-length cDNA from the genomic sequence.

Volume 88, Issue 5, Pages (March 1997)

Carlos Chuquillanqui1 • Ian Barker1

Phylogenetic characterization of the Bunyavirales-like viruses identified in this study. Phylogenetic characterization of the Bunyavirales-like viruses.

Novel PMS2 Pseudogenes Can Conceal Recessive Mutations Causing a Distinctive Childhood Cancer Syndrome Michel De Vos, Bruce E. Hayward, Susan Picton,

Carlos Chuquillanqui1 • Ian Barker1

Supplemental Figure S1. Alignment of drimenol synthase amino acid sequences from P. hydropiper and V. officinalis. Amino acid sequences were aligned with.

Multiple sequence alignment and analysis of SOFL proteins.

(A) Block diagram of the precursor proteins predicted from the Oak1, 2, 3, and 4 clones showing the signal peptide (light shading), the regions corresponding.

Julián Mateus1 • Stef de Haan2 Carlos Chuquillanqui2

Julián Mateus1 • Stef de Haan2 Carlos Chuquillanqui2

Lateral Transfer of an EF-1α Gene

WRKY transcription factors in potato genome factors in potato genome

The molecular basis of nuclear genetic code change in ciliates

Julián Mateus1 • Stef de Haan2 Carlos Chuquillanqui2

L. Dubourg Clinical Microbiology and Infection

Gene structures, positions of mutations, and protein domains of PRP18 paralogs in Arabidopsis. Gene structures, positions of mutations, and protein domains.

Alignment of H-NS, H-NS2, and StpA amino acid sequences.

Volume 88, Issue 5, Pages (March 1997)

AtG3BP1 is a homolog of the human HsG3BP1.

HUA1 and HUA2 Are Two Members of the Floral Homeotic AGAMOUS Pathway

Phylogenetic relationships within the family Astroviridae.

The C. elegans SYS-1 Protein Is a Bona Fide β-Catenin

Where would you draw the polyA tail in the gene above?______________

Amino acid alignment of TprK showing six different sequences in the T

Phylogenetic tree of perA A2-domain DNA sequence.

Comparative phylogenetic analysis of sapoviruses based on complete RdRp and VP1 nucleotide sequences. Comparative phylogenetic analysis of sapoviruses.

Selective Dimerization of a C2H2 Zinc Finger Subfamily

Volume 28, Issue 6, Pages (December 2007)

BRCA2 Is Required for Homology-Directed Repair of Chromosomal Breaks

Maximum likelihood (ML) unrooted tree based on the full-length 16S rRNA genes (A) and 31 conserved single-copy genes (B) showing the phylogenetic position.

Julián Mateus1 • Stef de Haan2 Carlos Chuquillanqui2

insomniac and Cullin-3 Regulate Sleep and Wakefulness in Drosophila

Volume 92, Issue 1, Pages 1-4 (January 1998)

Novel PMS2 Pseudogenes Can Conceal Recessive Mutations Causing a Distinctive Childhood Cancer Syndrome Michel De Vos, Bruce E. Hayward, Susan Picton,

Julián Mateus1 • Stef de Haan2 Carlos Chuquillanqui2

Bioinformatics analysis of the small TbTim amino acid sequences.

Identification of the GCS1 ortholog in Gonium pectorale.

Alignment of putative chicken HB-EGF to mammalian HB-EGF proteins and the domains of HB-EGF. Alignment of putative chicken HB-EGF to mammalian HB-EGF proteins.

Two cycad AOX genes, CrAOX1 and CrAOX2, showing different expression patterns in thermogenic male cones. Two cycad AOX genes, CrAOX1 and CrAOX2, showing.

Phylogenetic and convergence analyses of rpoB mutations.

Fig. 4. The predicted protein domains in sma

(A) yellow cDNA comparison among wild-type and ch mutants

General structure of RIFINs and STEVORs

Triangle plot summarizing the unsupervised population structure analysis of A. gambiae M, S, and A. arabiensis individuals assuming three populations.

SUR-8, a Conserved Ras-Binding Protein with Leucine-Rich Repeats, Positively Regulates Ras-Mediated Signaling in C. elegans Derek S Sieburth, Qun Sun,

Comparison of the sequences of Fzo/Mfn and structure of mammalian Mfn2

Phylogenetic analysis of AquK2P.

The C2H2 zinc-finger factor ztf-16 is required for ver-1 expression.

Neighbor-joining tree of the 262 S

Comparison of the predicted amino acid sequences of murine Rin (GenBank accession number U71202), human Rin (U71204), murine Rit (U71205), human Rit (U71203),

Sequence comparisons of fungal HOG1 orthologues.

Phylogenetic analyses showing the relationship between Ruminococcus, Blautia, and Clostridium on the basis of the sequences of the 16S region for each.

Primary structure of zebra finch CREB

Hinrich Gronemeyer, Arthur Zelent Cancer Cell

Evolutionary Fates and Origins of U12-Type Introns

Volume 97, Issue 6, Pages (June 1999)

Amino acid sequence similarity among C

Volume 1, Issue 5, Pages (September 2008)

Alignment of the Amino Acid Sequences of NCS and Other PR10/Bet v1 Proteins from Various Plant Species.Deduced amino acid sequences were aligned using.

Presentation transcript:

Phylogenetic analysis and amino acid sequences comparison of HO endonucleases. Phylogenetic analysis and amino acid sequences comparison of HO endonucleases. (A) Neighbor-joining (NJ) phylogeny as inferred from HO sequences depicting evolutionary relationships between Z. sapae and other hemiascomycetes. Numbers on branches indicate bootstrap support (1000 pseudoreplicates) from NJ. The Red branch indicates clusters, including ZrHO and ZsHO sequences, and the dark triangle indicates pre-WGD species. (B) Functional domains in PI-SceI and HO endonucleases. Primary amino acid alignment of S. cerevisiae PI-SceI (Sc-PI-SceI; GenBank: AA98762) and HO cloned in S. cerevisiae (Sc-HO; GenBank: CAA98806) and Z. sapae (ZsHO copy 1, GenBank: HG931720; ZsHO copy 2, GenBank: HG931721). Protein splicing domain with Hint motifs: A, Na, B, F, and G. Endonuclease domains C, D, E, and H. The DNA recognition region (DDR) and C-X2-C amino acid repeats (zinc) of putative zinc finger motifs at Sc-HO carboxyl-terminal are also shown (Bakhrat et al. 2004). In black shading are amino acid positions that are inferred to be critical for Sc-HO activity by analyzing naturally occurred or artificially induced HO mutants or by homology modeling with PI-SceI (Meiron et al. 1995; Ekino et al. 1999; Bakhrat et al. 2004; Ezov et al. 2010). In light gray, divergent positions between HO copies 1 and 2 in Z. sapae are shown. Amino acid identities are reported below the alignment following ClustalW rules: *, identity; :, conservative substitution; ., semiconservative substitution. Lisa Solieri et al. G3 2014;4:1011-1025 ©2014 by Genetics Society of America