Variable Number Tandem Repeats (VNTR) DNA Fingerprinting Variable Number Tandem Repeats (VNTR) VNTR, that you have just finished setting up, is technique that uses PCR to determine difference in the genetic make-up of individuals Before I we talk about VNTR we need to talk a little more about genetics and the makeup of genes

G N E Before when we talking about the genetic organization of the cell we stopped at how DNA was made out of nucleic acids that form genes Excluding sex linked genes what in the minimum number of copies of any one gene that you have (wait for student response) Two copies, one for each parent The DNA within the gene is transcribed into messanger RNA, which is then translated into protein. BUT not all the DNA within a gene codes for the protein. Do you know what are the two subunits that make a gene and which one actual codes for the protein? (wait for students response)? Introns and Exons click to reveal 1st answer Exon code for protein click to reveal 2nd answer Since exons code for protein everyone has the same exons for a specific gene, and today will be looking at the myoglobin gene, which is oxygen carrying molecule that is present in muscles cell and is very similar to hemoglobin. Any mutation within these exons can result in disease or death. A good example of this is sickle cell anemia. A mutation of one nuclei acid of the 626-bp code for part of the results in disease. What can vary from individual-to-individual are the introns, since for the most part they are junk DNA and mutations in them do not effect the final protein. As a result over time variation in the introns has developed in certain genes , and it is theses differences in between individuals that makes VNTR DNA fingerprinting technique work. The different genes of a pair are called alleles. You will inherit one allele from your mom and one from dad and they will be different from each other, as theirs are and every one else.

At the top here we have a myoglobin gene with its’ introns and exons. tandem repeats CTAAAGCTGGAGGTGGGCGGAGGACCGAGGT 16 bp repeat Exon 1 Exon 2 Exon 3 Intron Myoglobin gene Individual A Individual B Individual C A B C ATTGGGCGGAGGGGAGGTGGGCCGGAGGGGAGGTGGGCCGGAGGGGAGGTGGGCCGGAGGGGAGGTGGGCCGGAGGCCGATCATGCA TAACCCGCCTCCCCTCCACCCGGCCTCCCCTCCACCCGGCCTCCCCTCCACCCGGCCTCCCCTCCACCCGGCCTCCGGCTAGTACGA TAACCCGCCTCC   CCGATCATGCA At the top here we have a myoglobin gene with its’ introns and exons. Within the introns of myglobin, the DNA sequence has repeating sections called tandem repeats (click). The same 33 bp sequence of GATC is repeated. PCR Primers (click) (yellow) bind to the sequences on either side of the repeats (where there are no repeats). The more tandem repeats present in the intron the larger the product amplified. If we look at three individuals (click) with 6 different myoglobin alleles, one from each parent, we see they have different numbers of tandem repeats (yellow). If we amplify these introns using our primers and then run them on a agrose gel we see three district VNTR patterns.

DNA Fingerprinting #2 and #6 #4 and #5 #4 and #6 Who did it? Crime Scene 5. Prime suspect Who are the parents of #3? Now, onto your crime scene - Lane L is molecular weight ladder (100bp) Lane 1 is blood found at the crime scene that did not match the victims. Click for crime scene to appear Lanes 2 through 8 are VNRT profiles potential suspects – people who had access to the crime scene Based on DNA evidence who is the prime suspect in the case? Click to reveal answer #5 Why? The band patterns match – length. What is the size of the bands – roughly? #bp Do you think these people are related? YES. Why? Shared bands. In this way VNTRs can be used to show relationships between people. If I told you that #3 was a child, tell me (Click to reveal) Who are the parents of #3 (wait for students response, if students get stuck or got most of the combinations click to reveal hint) (once all combinations give click to reveal answers). If I told you that myoglobin gene was located on chromosome 11 can you tell me tell be the sex of the child? (wait for students response) No, Chromosome 11 is a autosomal chromosome so we can not let anything about the sex of the individual If we wanted to determine the sex of the child we would have to target the X or Y sex chromosomes. Hint 4 combinations #2 and #5 #2 and #6 #4 and #5 #4 and #6

DNA Fingerprinting Family Relationships of #3 (child) #2 Mother #5 Father #4 Mother’s Mom #6 Father’s sister #7 and #8 are the children of #6. #7 and #8 could be siblings or even identical twins Family Relationships - Some answers - Click for each one to appear We know that #2 Mother and #5 Father, though from this gel you can only tell that #2 and # 5 are the possible parents of #3. SO who is #4? – that person was a possible parent. #4 Mother’s Mom (kid’s grandma), or any blood relative on mothers side Similarly then #6 Father’s sister (kid’s aunt, or any relative on fathers side. And in our case, #7 and #8 are the children of #6 (oh, cousins!) How are #7 and #8 related? Twins - IDENTICAL Can they be just regular siblings? YES Is this as likely as them being twins? NO Why? (they won’t know) How many alleles do their mom and dad have? 2 each So what is the probability of inheriting any particular band pattern? ½ from mom and ½ from dad, ½ x ½ = ¼ (demo or discuss it) So what is the probability that twins have the same pattern as compared to just sibs? ¼ for twins and ¼ x ¼ for a different birth (or fraternal twins) = 1/16 – This is how inheritance and genetics works and what is used in genetic counseling.

DNA Fingerprinting Homozygous Why does #2 appear to have only one band? Homozygous Why does #2 appear to have only one band (wait for students response) They are homozygous, meaning they inherited the same allele from both parents. You may have to introduce the word homozyous. Then also introduce heterozygous – greek words meaning same/different zygotes or embryos. If you look closely you can see that the band is brighter than the other band, and that is because there is more DNA present

DNA Fingerprinting Actual Results #2,3,5 are a family #4, 6, 7 and 8 are unrelated to the family.   #7 and 8 are not related either.  In fact one comes from Hungary and one from Japan.  The odds of these two patterns being the same are 1/900,000 The TRUTH! Actual results Blood samples were collect from people within the Faculty of Medicine #2, 3, 5 are a family #4,6,7, and 8 are unrelated to the family #7and #8 are unrelated In fact one comes from Hungary and the other Japan What do you think the odds of two unrelated individual having the same banding pattern? (wait for students to responded) In this case it is 1/900,000 If we were to look only at this one gene there could be two individuals in Calgary, which is 900,000 big) that would have the same banding pattern. Do you think this would be enough convict someone of a crime? (wait for response) No!! What would you do to ensure that you had the guilt party? (wait for response) look at more genes Using four loci, the probability that you'd find a given allele combination in the general population is somewhere around 1 in 5,000,000. In the United States, the FBI incorporates 13 sites on average into its profiles. With 26 different bands studied, you'd be incredibly hard pressed to find two unrelated individual with the same DNA profile; the odds of a match in this case are well more than one in a hundred billion.