A HOX Gene Mutation in a Family with Isolated Congenital Vertical Talus and Charcot- Marie-Tooth Disease Antony E. Shrimpton, E. Mark Levinsohn, Justin.

Slides:

Advertisements

Similar presentations

Connexin Mutations in Skin Disease and Hearing Loss David P. Kelsell, Wei-Li Di, Mark J. Houseman The American Journal of Human Genetics Volume 68, Issue.

Advertisements

Functional Analysis of the Neurofibromatosis Type 2 Protein by Means of Disease- Causing Point Mutations Renee P. Stokowski, David R. Cox The American.

The Gene for Glycogen-Storage Disease Type 1b Maps to Chromosome 11q23

Identification of a Major Susceptibility Locus for Restless Legs Syndrome on Chromosome 12q Alex Desautels, Gustavo Turecki, Jacques Montplaisir, Adolfo.

Homozygous Defects in LMNA, Encoding Lamin A/C Nuclear-Envelope Proteins, Cause Autosomal Recessive Axonal Neuropathy in Human (Charcot-Marie-Tooth Disorder.

Mapping of Autosomal Dominant Osteopetrosis Type II (Albers-Schönberg Disease) to Chromosome 16p13.3 Olivier Bénichou, Erna Cleiren, Jeppe Gram, Jens.

Genetic Linkage of Paget Disease of the Bone to Chromosome 18q

Localization of a Gene (MCUL1) for Multiple Cutaneous Leiomyomata and Uterine Fibroids to Chromosome 1q42.3-q43 N.A. Alam, S. Bevan, M. Churchman, E.

Use of Homozygosity Mapping to Identify a Region on Chromosome 1 Bearing a Defective Gene That Causes Autosomal Recessive Homozygous Hypercholesterolemia.

Homozygous Deletion of the Very Low Density Lipoprotein Receptor Gene Causes Autosomal Recessive Cerebellar Hypoplasia with Cerebral Gyral Simplification

Mutations in TPRN Cause a Progressive Form of Autosomal-Recessive Nonsyndromic Hearing Loss Yun Li, Esther Pohl, Redouane Boulouiz, Margit Schraders,

An Autosomal Dominant Thrombocytopenia Gene Maps to Chromosomal Region 10p Anna Savoia, Maria Del Vecchio, Antonio Totaro, Silverio Perrotta, Giovanni.

A Novel Alu-Like Element Rearranged in the Dystrophin Gene Causes a Splicing Mutation in a Family with X-Linked Dilated Cardiomyopathy Alessandra Ferlini,

L. M. Downey, T. J. Keen, E. Roberts, D. C. Mansfield, M. Bamashmus, C

The SPCH1 Region on Human 7q31: Genomic Characterization of the Critical Interval and Localization of Translocations Associated with Speech and Language.

A Combined Linkage-Physical Map of the Human Genome

The Gene for Glycogen-Storage Disease Type 1b Maps to Chromosome 11q23

Tamara Rogers, David Chandler, Dora Angelicheva, P. K

A Family with Isolated Hyperparathyroidism Segregating a Missense MEN1 Mutation and Showing Loss of the Wild-Type Alleles in the Parathyroid Tumors Bin.

Mapping of Primary Congenital Lymphedema to the 5q35.3 Region

The Gene for Severe Combined Immunodeficiency Disease in Athabascan-Speaking Native Americans Is Located on Chromosome 10p Lanying Li, Dennis Drayna,

A Novel Syndrome Combining Thyroid and Neurological Abnormalities Is Associated with Mutations in a Monocarboxylate Transporter Gene Alexandra M. Dumitrescu,

Peter Ianakiev, Michael W

Ehlers-Danlos Syndrome with Severe Early-Onset Periodontal Disease (EDS-VIII) Is a Distinct, Heterogeneous Disorder with One Predisposition Gene at Chromosome.

Lan Xiong, Malgorzata Labuda, Dong-Sheng Li, Thomas J

Evidence for a Nonallelic Heterogeneity of Epidermodysplasia Verruciformis with Two Susceptibility Loci Mapped to Chromosome Regions 2p21–p24 and 17q25

A Second Gene for Autosomal Dominant Möbius Syndrome Is Localized to Chromosome 10q, in a Dutch Family H.T.F.M. Verzijl, B. van den Helm, B. Veldman,

Identification of a Genetic Locus for Ichthyosis Vulgaris on Chromosome 10q22.3– q24.2 Ping Liu, Qingyu Yang, Xu Wang, Aiping Feng, Tao Yang, Rong Yang,

Howard B. Yeon, Noralane M. Lindor, J.G. Seidman, Christine E. Seidman

John D. Rioux, Valerie A. Stone, Mark J

Familial Juvenile Hyperuricemic Nephropathy: Localization of the Gene on Chromosome 16p11.2—and Evidence for Genetic Heterogeneity Blanka Stibůrková,

A Gene for Familial Juvenile Polyposis Maps to Chromosome 18q21.1

Kimberly C. Sippel, Rebecca E. Fraioli, Gary D. Smith, Mary E

Genetic Background of Congenital Chloride Diarrhea in High-Incidence Populations: Finland, Poland, and Saudi Arabia and Kuwait Pia Höglund, Mari Auranen,

Refinement of the Locus for Autosomal Recessive Retinitis Pigmentosa (RP25) Linked to Chromosome 6q in a Family of Pakistani Origin Shagufta Khaliq,

Airong Li, Sonia Davila, Laszlo Furu, Qi Qian, Xin Tian, Patrick S

The Origins of Hypertrophic Cardiomyopathy–Causing Mutations in Two South African Subpopulations: A Unique Profile of Both Independent and Founder Events

Hal M. Hoffman, Fred A. Wright, David H. Broide, Alan A

A Locus for Brachydactyly Type A-1 Maps to Chromosome 2q35-q36

Mapping of Charcot-Marie-Tooth Disease Type 1C to Chromosome 16p Identifies a Novel Locus for Demyelinating Neuropathies Valerie A. Street, Jeff D. Goldy,

A Novel Point Mutation Affecting the Tyrosine Kinase Domain of the TRKA Gene in a Family with Congenital Insensitivity to Pain with Anhidrosis Shinichi.

E. Warwick Daw, Simon C. Heath, Ellen M. Wijsman

A Recurrent Expansion of a Maternal Allele with 36 CAG Repeats Causes Huntington Disease in Two Sisters Franco Laccone, Wilhelm Christian The American.

Localization of a Gene for Duane Retraction Syndrome to Chromosome 2q31 Binoy Appukuttan, Elizabeth Gillanders, Suh-Hang Juo, Diana Freas-Lutz, Sandra.

Koji Suzuki, Tania Bustos, Richard A. Spritz

A Mutation in the Variable Repeat Region of the Aggrecan Gene (AGC1) Causes a Form of Spondyloepiphyseal Dysplasia Associated with Severe, Premature.

Linkage Analysis Identifies a Novel Locus for Restless Legs Syndrome on Chromosome 2q in a South Tyrolean Population Isolate Irene Pichler, Fabio Marroni,

Genetic Linkage of Autosomal-Dominant Alport Syndrome with Leukocyte Inclusions and Macrothrombocytopenia (Fechtner Syndrome) to Chromosome 22q11-13

Homozygosity and Linkage-Disequilibrium Mapping of the Syndrome of Congenital Hypoparathyroidism, Growth and Mental Retardation, and Dysmorphism to a.

John A. Martignetti, Karen E

Retinitis Pigmentosa and Progressive Sensorineural Hearing Loss Caused by a C12258A Mutation in the Mitochondrial MTTS2 Gene Fiona C. Mansergh, Sophia.

Ryan McDaniell, Daniel M. Warthen, Pedro A

Evidence That the Penetrance of Mutations at the RP11 Locus Causing Dominant Retinitis Pigmentosa Is Influenced by a Gene Linked to the Homologous RP11.

Vandana Shashi, Margaret N. Berry, Sarah Shoaf, James J

Dominique J. Verlaan, Adrian M. Siegel, Guy A. Rouleau

A Unique Point Mutation in the PMP22 Gene Is Associated with Charcot-Marie-Tooth Disease and Deafness Margaret J. Kovach, Jing-Ping Lin, Simeon Boyadjiev,

Hereditary Isolated Renal Magnesium Loss Maps to Chromosome 11q23

Oligodontia Is Caused by Mutation in LTBP3, the Gene Encoding Latent TGF-β Binding Protein 3 Abdul Noor, Christian Windpassinger, Irina Vitcu, Marija.

Anthony M. Raizis, Martin M. Ferguson, David T. Nicholls, Derek W

Mutation Analysis of UBE3A in Angelman Syndrome Patients

Identification, by Homozygosity Mapping, of a Novel Locus for Autosomal Recessive Congenital Ichthyosis on Chromosome 17p, and Evidence for Further Genetic.

A Gene for an Autosomal Dominant Scleroatrophic Syndrome Predisposing to Skin Cancer (Huriez Syndrome) Maps to Chromosome 4q23 Young-Ae Lee, Howard P.

Simone Sanna-Cherchi, Gianluca Caridi, Patricia L

A Gene for Autosomal Recessive Spondylocostal Dysostosis Maps to 19q13

Frances R. Goodman, Frank Majewski, Amanda L. Collins, Peter J

Exon Skipping in IVD RNA Processing in Isovaleric Acidemia Caused by Point Mutations in the Coding Region of the IVD Gene Jerry Vockley, Peter K. Rogan,

A Locus for Autosomal Dominant Hereditary Spastic Ataxia, SAX1,Maps to Chromosome 12p13 I.A. Meijer, C.K. Hand, K.K. Grewal, M.G. Stefanelli, E.J. Ives,

Identification of Novel pro-α2(IX) Collagen Gene Mutations in Two Families with Distinctive Oligo-Epiphyseal Forms of Multiple Epiphyseal Dysplasia Paul.

Glycyl tRNA Synthetase Mutations in Charcot-Marie-Tooth Disease Type 2D and Distal Spinal Muscular Atrophy Type V Anthony Antonellis, Rachel E. Ellsworth,

Brachydactyly Type B: Clinical Description, Genetic Mapping to Chromosome 9q, and Evidence for a Shared Ancestral Mutation Yaoqin Gong, David Chitayat,

Presentation transcript:

A HOX Gene Mutation in a Family with Isolated Congenital Vertical Talus and Charcot- Marie-Tooth Disease Antony E. Shrimpton, E. Mark Levinsohn, Justin M. Yozawitz, David S. Packard, Robert B. Cady, Frank A. Middleton, Antonio M. Persico, David R. Hootnick The American Journal of Human Genetics Volume 75, Issue 1, Pages 92-96 (July 2004) DOI: 10.1086/422015 Copyright © 2004 The American Society of Human Genetics Terms and Conditions

Figure 1 A, Pedigree showing individuals from whom DNA was isolated (bars below symbol). Individuals marked with an asterisk (*) were included in the original 10K Array linkage study. The bars represent the 2q31 chromosomal section between markers D2S124 and D2S1391. B, Critical-region haplotypes in affected individuals, in more detail. All 16 affected individuals—but no unaffected individuals—contain the same chromosomal section distal to D2S1267 and proximal to D2S2978 (boxed). V=CVT; M=CMT; B=CVT and CMT; N=unaffected. An asterisk (*) indicates a presumed 5–6 reversion mutation. The American Journal of Human Genetics 2004 75, 92-96DOI: (10.1086/422015) Copyright © 2004 The American Society of Human Genetics Terms and Conditions

Figure 2 Radiographs of individual V:2 at age 9 years. Despite casting for CVT at age 6 mo, the left foot still shows CVT (A), and the right foot shows a high arch (arrow) and claw toes typical of CMT (B). n=navicular; T=talus; c=calcaneus. Adapted from E.M.L., A.E.S., D.S.P., R.B.C., and D.R.H. (unpublished data). The American Journal of Human Genetics 2004 75, 92-96DOI: (10.1086/422015) Copyright © 2004 The American Society of Human Genetics Terms and Conditions

Figure 3 A, Electropherogram showing M319K mutation sequence. B, NlaIII digested 181-bp products, run on a 2% agarose gel from a subset of affected and unaffected family members. Since the HOXD10 M319K mutation does not alter a naturally occurring restriction enzyme recognition site, a primer (TCAAGATTTGGTTTCAAAACCGCCGC*A) was designed that would create an NlaIII site in combination with wild-type sequence but not with the M319K mutation. The American Journal of Human Genetics 2004 75, 92-96DOI: (10.1086/422015) Copyright © 2004 The American Society of Human Genetics Terms and Conditions

Figure A1 Whole-genome haplotype–based parametric linkage map at LOD>1.88 The American Journal of Human Genetics 2004 75, 92-96DOI: (10.1086/422015) Copyright © 2004 The American Society of Human Genetics Terms and Conditions