UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations Alternative alleles (traits) of many genes result from changes.

Slides:



Advertisements
Similar presentations
Chapter 13.3 (Pgs ): Mutations
Advertisements

Chapter 17.5 Gene expression and Mutations
Transcription, Translation Review. Mutations and Genetic Modifications.
Mutations Chapter 12.4.
Chapter 14 Homework is due on Sunday, January 25 at 11:59 pm The Chapter 13 and 14 test is on Monday.
NOTES – CH 17, part 2 DNA & MUTATIONS
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.
8.7 Mutations A mutation is a change in an organism’s DNA. This may or may not affect phenotype.
Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)
Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.
Mutation. What you need to know How alteration of chromosome number or structurally altered chromosomes can cause genetic disorders How point mutations.
A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.
8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.
Mutations.
The Cell Cycle.
12.4 Assessment Answers.
Mutations and Nature vs. Nurture.
Chapter 14 GENETIC VARIATION.
Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.
Mutations.
Mutations (12.4) State Standard
Mutations.
A mutation is a change in an organism’s DNA.
Mutations.
GENETIC MUTATIONS Section 5.6 Pg. 259.
Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.
DNA and mutations SC.912.L.16.4.
Copyright Pearson Prentice Hall
Gene Mutations.
Mutations.
MUTATIONS.
Genetic Mutations.
13.3_Mutations SC.912.L.16.4 Explain how mutations in DNA sequence may or may not result in phenotypic change. Explain how mutations in gametes may result.
Mutations.
Mutations.
Gene Expression & Mutations
Types of point mutations
To be successful today…
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations -changes in a single base pair in DNA=changes in the nucleotide.
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA.
Chapter 11.6 When it all goes Wrong
Some mutations affect a single gene, while others affect an entire chromosome.
Mutations Section 12-4.
Mutations.
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA.
Distinguish between codon and anticodon.
A mutation is a change in an organism’s DNA.
Mutations Chapter 8.7.
MUTATIONS.
Gene and Chromosomal Mutations
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Draw a conclusion from this graph for both the red and blue line
MUTATIONS.
A mutation is a change in an organism’s DNA.
A mutation is a change in an organism’s DNA.
Mutation Notes.
Copyright Pearson Prentice Hall
A mutation is a change in an organism’s DNA.
11.3 Section Objectives – page 296
Section 20.4 Mutations and Genetic Variation
A mutation is a change in an organism’s DNA.
Protein Synthesis and Mutation
Mutations: Changes in Genes
Presentation transcript:

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations Alternative alleles (traits) of many genes result from changes in a single base pair in DNA=changes in the nucleotide sequence 2 general categories: a. Base substitutions b. Base insertions or deletions  

=mutagenesis Causes of Mutation-creation of mutations Chapter 12 Molecular Genetics 12.4 Gene Regulation and Mutation Causes of Mutation-creation of mutations =mutagenesis Can occur spontaneously during replication or recombination-called Spontaneous mutations Radiation such as UV rays and X rays Chemicals – Mutagens & carcinogens Nondisjunction Viral Infection- HPV

Mutations Physical or chemical agent that could cause a mutation is called a mutagen ex. Radiation Mutations can be harmful or useful b/c of mutation there is variety in us! essential for geneticists-create different alleles needed for genetic research

Body-cell v. Sex-cell Mutation Chapter 12 Molecular Genetics 12.4 Gene Regulation and Mutation Body-cell v. Sex-cell Mutation Somatic cell mutations are not passed on to the next generation. Mutations that occur in sex cells are passed on to the organism’s offspring and will be present in every cell of the offspring.

Mutations Base Substitutions Replacement of one nucleotide with another Can result in no change in the Protein, insignificant changes or might be crucial Ex. Sickle cell anemia Has a single difference in amino acid (a valine instead of a glu.) Protein can’t perform normally

Sickle Cell Anemia

Types of Base Substitution Mutations Chapter 12 Molecular Genetics 12.4 Gene Regulation and Mutation Types of Base Substitution Mutations Silent: causes no change in the amino acid sequence Missense: causes a change in one amino acid only Nonsense: introduces a stop codon into the mRNA strand

Mutations Frameshift mutations Base insertions or deletions Can be disastrous=add or delete nucleotides May alter the reading frame (triplet grouping) of the genetic message Regrouped into different codons

Chromosomal mutations Change in the number or structure of the chromosomes Duplication Inversion Translocation

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2024 SlidePlayer.com Inc. All rights reserved.