To be successful today…

Slides:

Advertisements

Similar presentations

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

Advertisements

Mutations Section 12–4 This section describes and compares gene mutations and chromosomal mutations.

13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)

What exactly is a mutated gene? Nope, that’s not it.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

12.4 Mutations Copyright Pearson Prentice Hall.. What Are Mutations? Changes in the nucleotide sequence of DNA (genetic material) May occur in somatic.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

MUTATIONS Intro video

Mistakes in the code. Review: What does DNA look like? How is DNA for a new cell made? How does DNA instruct the cell to make proteins? What determines.

4.12 DNA and Mutations. Quick DNA Review Base pairing Base pairing.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

Mutation Notes: Chapter 11.

Mutations and Nature vs. Nurture.

Mermaid Syndrome Video.

Gene Mutations Chapter 11.

Copyright Pearson Prentice Hall

Gene Mutations.

Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

Kinds of Mutations Point Mutation Occur at a single point in the DNA

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Some mutations affect a single gene, while others affect an entire chromosome.

Mutations Section 12-4.

Changes in the nucleotide sequence of DNA or mRNA

4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.

A mutation is a change in an organism’s DNA.

Mutations Ms MacCormack Fall 2018.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Draw a conclusion from this graph for both the red and blue line

Mutation, Natural Selection, and Artificial Selection

Mutation Notes.

Mutations: Changes in Genes

Presentation transcript:

To be successful today… 1) Pull out scissors, glue & biology notebook

Mutations

Any mistake or change in DNA sequence Mutations Any mistake or change in DNA sequence What causes them? Random or Environment influences – X-rays, UV rays, radioactive materials, chemicals

Mutations Mutations can happen in body (somatic) cells or sex cells (gametes)

More about mutations Can be beneficial, harmless, or harmful 2 types: Gene & Chromosomal

Chromosomal mutation: affects whole or part of a chromosome Gene mutation: Changes to the bases in the DNA of ONE gene

1. Gene Mutations Change in one or more nucleotides Affects the amino acids and protein 2 types

 Point Mutation (Substitution) Change in a single base pair in DNA Ex: The dog bit the CAT The dog bit the CAR

Sickle Cell Anemia

 Frameshift Mutation Single base is added or deleted from DNA Changes the reading frame of the mRNA (the groups of 3).

Frameshift Mutation Alters every amino acid after insertion or deletion

Practice - Which mutations are these? 1 2 4 3 6 5

Gene Mutations Video