Title Detection of HLA-B*58:01 with TaqMan assay and its association with allopurinol-induced sCADR.

Slides:

Advertisements

Similar presentations

Research Techniques Made Simple: Polymerase Chain Reaction

Advertisements

By Gracie Canales August 10, 2010

Quantitative PCR Session 2: Overview of qPCR

Results Alien Reference RNA QRT-PCR Detection Kit for Monitoring the Overall Performance of QRT-PCR Assays Bahram Arezi, Melissa McCarthy & Holly Hogrefe.

Chapter 13: DNA Quantitation.  Quantitation determines the amount of human DNA present in an extract  A narrow concentration range is required to “seed”

qPCR SNAPSHOTS LIVE MAY 13, 2003.

A RAPID AND INNOVATIVE METHOD FOR THE IDENTIFICATION OF THE COMMONEST G6PD ITALIAN MUTATIONS A. Minucci, L. Gentile, S. Rocchetti, C. Zuppi, B. Giardina.

HCV PCR By Henrietta Orji July 31 st, 2010 Hepatitis C Virus by Polymerase Chain Reaction.

Rapid and Reliable Genotyping of HLA-B*58:01 in Four Chinese Populations Using a Single-tube Duplex Real-time PCR assay Huijuan Wang, Ph.D The National.

Results 1 comparison for 5 systems containing the SNP at postion 1 to 5 of the up-stream probe  systems 2-5 work well, system 3 offers most stable & reliable.

Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Introduction to PCR Polymerase Chain Reaction

HRM REAL TIME PCR Presented by: Dadkhah Fahimeh SNP genotyping by HRM REAL TIME PCR.

The Factor II (Prothrombin) G20210A Detection and Genotyping

Unit 1 – Living Cells.  The study of the human genome  - involves sequencing DNA nucleotides  - and relating this to gene functions  In 2003, the.

Higher Human Biology Unit 1 Human Cells KEY AREA 5: Human Genomics.

HRM Assay and Optimization 1. DNA Quality 2. Amplicon LengthAmplicon  lengths of 100–300 bp 3. Primer Selection 4. Dye Selection 5. MgCl2 Concentration.

Research Techniques Made Simple: Polymerase Chain Reaction

Introduction to PCR Polymerase Chain Reaction

Anajane G. Smith1, 2 Shalini E. Pereira1, 2 Dan E. Geraghty1, 2

A Melting Curve Analysis–Based PCR Assay for One-Step Genotyping of β- Thalassemia Mutations Fu Xiong, Qiuying Huang, Xiaoyun Chen, Yuqiu Zhou, Xinhua.

Synthetic Circulating Cell-free DNA as Quality Control Materials for Somatic Mutation Detection in Liquid Biopsy for Cancer R. Zhang, R. Peng, Z. Li, P.

Quantitative Detection and Differentiation of Human Herpesvirus 6 Subtypes in Bone Marrow Transplant Patients by Using a Single Real-Time Polymerase Chain.

Clinical Validation of a New Triplex Real-Time Polymerase Chain Reaction Assay for the Detection and Discrimination of Herpes simplex Virus Types 1 and.

ASM 2017 Microbe Annual Meeting Sunday-507

1Department of Esoteric Testing/R&D, Tampa General Hospital, Tampa, FL

Direct DNA Amplification from Crude Clinical Samples Using a PCR Enhancer Cocktail and Novel Mutants of Taq Zhian Zhang, Milko B. Kermekchiev, Wayne.

Development of a simultaneous identification method for 13 animal species using two multiplex real-time PCR assays and melting curve analysis Natsumi.

Pre-Clinical Validation of a Novel, Highly Sensitive Assay to Detect PML-RARα mRNA Using Real-Time Reverse-Transcription Polymerase Chain Reaction James.

Simultaneous Genotyping of α-Thalassemia Deletional and Nondeletional Mutations by Real-Time PCR–Based Multicolor Melting Curve Analysis Qiuying Huang,

Validation of a Commercially Available Screening Tool for the Rapid Identification of CGG Trinucleotide Repeat Expansions in FMR1 Grace X.Y. Lim, Yu.

Direct DNA Amplification from Crude Clinical Samples Using a PCR Enhancer Cocktail and Novel Mutants of Taq Zhian Zhang, Milko B. Kermekchiev, Wayne.

Rapid Detection of the Epidermal Growth Factor Receptor Mutation in Non-Small-Cell Lung Cancer for Analysis of Acquired Resistance Using Molecular Beacons

Dual detection of Legionella pneumophila and Legionella species by real-time PCR targeting the 23S-5S rRNA gene spacer region G. Yang, R. Benson, T.

Quantitative detection of Toxoplasma gondii DNA in human body fluids by TaqMan polymerase chain reaction O. Kupferschmidt, D. Krüger, T.K. Held, H. Ellerhrok,

Nested Polymerase Chain Reaction With Sequence-Specific Primers Typing for HLA-A, -B, and -C Alleles: Detection of Microchimerism in DR-Matched Individuals.

Comparison of BIOMED-2 Versus Laboratory-Developed Polymerase Chain Reaction Assays for Detecting T-Cell Receptor-γ Gene Rearrangements Keyur P. Patel,

Clinical Validation of a New Triplex Real-Time Polymerase Chain Reaction Assay for the Detection and Discrimination of Herpes simplex Virus Types 1 and.

Molecular Analysis of Circulating Cell-Free DNA from Lung Cancer Patients in Routine Laboratory Practice Stephan Bartels, Sascha Persing, Britta Hasemeier,

Application of Single-Molecule Amplification and Resequencing Technology for Broad Surveillance of Plasma Mutations in Patients with Advanced Lung Adenocarcinoma

A Melting Curve Analysis–Based PCR Assay for One-Step Genotyping of β- Thalassemia Mutations Fu Xiong, Qiuying Huang, Xiaoyun Chen, Yuqiu Zhou, Xinhua.

B-Cell Clonality Determination Using an Immunoglobulin κ Light Chain Polymerase Chain Reaction Method Reetesh K. Pai, Artemis E. Chakerian, John M. Binder,

Application of Single-Molecule Amplification and Resequencing Technology for Broad Surveillance of Plasma Mutations in Patients with Advanced Lung Adenocarcinoma

Single Nucleotide Polymorphism-Based System Improves the Applicability of Quantitative PCR for Chimerism Monitoring Egle Gineikiene, Mindaugas Stoskus,

Clinical Relevance of Sensitive and Quantitative STAT3 Mutation Analysis Using Next- Generation Sequencing in T-Cell Large Granular Lymphocytic Leukemia

Hou-Sung Jung, Gregory J. Tsongalis, Joel A. Lefferts

DNA Diagnostics by Surface-Bound Melt-Curve Reactions

“TaqMan genotyping Assay’’

Simultaneous Genotyping of α-Thalassemia Deletional and Nondeletional Mutations by Real-Time PCR–Based Multicolor Melting Curve Analysis Qiuying Huang,

Molly Yancovitz, Joanne Yoon, Maryann Mikhail, Weiming Gai, Richard L

Rapid and Accurate Detection of Monoclonal Immunoglobulin Heavy Chain Gene Rearrangement by DNA Melting Curve Analysis in the LightCycler System Dongsheng.

Rapid Detection of Clonal T-Cell Receptor-β Gene Rearrangements in T-Cell Lymphomas Using the LightCycler-Polymerase Chain Reaction with DNA Melting Curve.

Rapid Detection of Haptoglobin Gene Deletion in Alkaline-Denatured Blood by Loop- Mediated Isothermal Amplification Reaction Mikiko Soejima, Kouichi Egashira,

Identification of Bacteria BBT203 Ach

Use of Single Nucleotide Polymorphisms (SNP) and Real-Time Polymerase Chain Reaction for Bone Marrow Engraftment Analysis Dwight H. Oliver, Richard E.

Isothermal Strand-Displacement Polymerase Reaction for Visual Detection of the Southeast Asian–Type Deletion of α-Thalassemia Luxin Yu, Wei Wu, Puchang.

Development and Validation of a Template-Independent Next-Generation Sequencing Assay for Detecting Low-Level Resistance-Associated Variants of Hepatitis.

DNA Fingerprinting and Forensic Analysis

Efficient and Highly Sensitive Screen for Myotonic Dystrophy Type 1 Using a One-Step Triplet-Primed PCR and Melting Curve Assay Mulias Lian, Indhu-Shree.

Molecular Monitoring of Chronic Myelogenous Leukemia

Rapid One-Step Carrier Detection Assay of Mucolipidosis IV Mutations in the Ashkenazi Jewish Population Feras M. Hantash, Susan C. Olson, Ben Anderson,

Development of an Allele-Specific Real-Time PCR Assay for Discrimination and Quantification of p63 R279H Mutation in EEC Syndrome Vanessa Barbaro, Letizia.

Rapid and Sensitive Real-Time Polymerase Chain Reaction Method for Detection and Quantification of 3243A>G Mitochondrial Point Mutation Rinki Singh,

Low Incidence of Minor BRAF V600 Mutation-Positive Subclones in Primary and Metastatic Melanoma Determined by Sensitive and Quantitative Real-Time PCR

Amplification Refractory Mutation System, a Highly Sensitive and Simple Polymerase Chain Reaction Assay, for the Detection of JAK2 V617F Mutation in Chronic.

Rapid and Accurate Detection of Monoclonal Immunoglobulin Heavy Chain Gene Rearrangement by DNA Melting Curve Analysis in the LightCycler System Dongsheng.

Visual Format for Detection of Mycobacterium tuberculosis and M

Triplex-forming Peptide Nucleic Acids Induce Heritable Elevations in Gamma-globin Expression in Hematopoietic Progenitor Cells Joanna Y Chin, Faisal.

Research Techniques Made Simple: Polymerase Chain Reaction

Presentation transcript:

Title Detection of HLA-B*58:01 with TaqMan assay and its association with allopurinol-induced sCADR.

outline Introduction Methods of study Results of the study Conclusion Statistics for the sickness and treatment Focus of the study Methods of study Sampling Preparation of samples Primer design Optimized PCR reaction condition figures Results of the study Identification of HLA-B*58:01 gene Accuracy, specificity and sensitivity Tables and figures Conclusion

Introduction The current methods of testing HLA-B*58:01have been determined as too laborious such that it is a challenge to use them in the routine clinical detection. This article concentrates on developing new methods of detecting HLA- B*58:01 and TaqMan assay as well as investigating its association to allopurinol-induced sCADR. It is estimated that 2% of men with 30 years and above and women with 50 years and above develop hyperuricemia and gout.

Methods of study The method of the study include developing a combination of sequence- specific primers(SSP) together with TaqMan probe amplification in order to determine presence of HLA-B*58:01 in various groups. The groups to be used for the study include : 28 healthy people, allopurinol-induced sCADR group of 48 and 133 people who are allopurinol-tolerant The commonly used method of detecting HLA-B*58:01 is the screening method, which is inconvenient for use in most hospitals.

Preparing samples The samples of the three groups were collected. The concentration of the DNA was tested and evaluated to be 20 to 200 ng/μL. The OD, on the other hand, was 1.65 to 1.85. The temperatures of the DNA samples were maintained at a temperature of 80 °C. The genomic DNA were extracted from EDTA-ant-coagulated blood samples through DNA blood Mini Kit. During samples preparation, each step has to be keenly followed to obtain perfect results.

Primer design To genotype patients for the HLA-B*58:01, polymerase chain reactions was carried out by use of SSPs. A mismatch was later inserted to the second and third base for facilitation of HLA-B alleles. To determine quality of the DNA samples, a β-globin gene was employed as the quality control. A pair of primers was used in combination with two TaqMan probes where specific primers used to amplify portions of exon 2 and 3.

. The quality control was estimated to contain 2 × KAPA® PROBE FAST qPCR Master Mix and other elements that led to an overall of 20 hydrated μL volume. In the reactions, as well, the performed TaqMan real-time PCR had ABI 7500 PCR systems that were real-time. The temperature conditions were regulated after every 3 min and the resultant fluorescence were determined after every cycle. Quality control is relevant in the method and it helped to obtain regulated results. Maintaining temperature conditions after every 3min helped to obtaone varying fluorescence for experiment.

The sequence-specific primers together with TaqMan probe locations can be illustrated as shown in the figure below.

Specific Primers as well as TaqMan probes for HLA-B Specific Primers as well as TaqMan probes for HLA-B*58:01 allele can be illustrated as shown in the table below. Sequence (5’-3’) Primer 5801-F GGGCCGGAGTATTGGGATG 5801-R GCCATACATCCTCTGGATGA β-Globin-F AGTCAGGGCAGAGCCATCTA β-Globin-R TTAGGGTTGCCCATAACAGC TaqMan probe 5810-probe1 JOE-ACCGAGAGAACCTGCGGATCGCGCTCC-BHQ2 5810-probe2 CY5-TCCGAGATCCGCCTCCCTGAGGCC-BHQ2 β-Globin-probe FAM-AGTCTGCCGTTACTGCCCTGTGG-TAMRA

Results of the study The new method employed was successful identifying HLA-B*58:01in many alleles of HLA-B. The results obtained in the 344 DNA samples were determined to be concordant with the results obtained in commercial PCR-SSP HLA-B Kit. Finally, the results showed that samples which generated JOE and CY5 had HLAB*58:01 allele while those that had no signal of HLAB*58:01 allele had a successful amplification of a single probe type. The results obtained revealed that the method used to test HLA-B*58:01 was successful. The method can therefore be used to supplement the screening method which is incomvenient in most hospitals.

Accuracy, specificity and sensitivity 89 DNA samples from the various groups simultaneously generated JOE and CY5 amplification curves during the HLA-B gene reaction as well as a β-globin gene reaction which indicated that the samples had HLA-B*58:01 allele (Zhang, 2015 pg. 386). The rest of the 225 DNA samples that did not generate fluorescence amplification indicated that the HLA-B*58:01 was negative. The accuracy of the study can be determined by the simultaneous amplification of curves which revealed that each of the sample was accurately studied. The results obtained, therefore, were valid.

The results of HLA-B*58:01 allele frequency in sCADR, control groups and allopurinol-tolerant can be illustrated in a table as follows: (Zhang,2015 pg. 388) HLA-B*58:01 OR (95% CI) Allopurinol-induced sCADR 93.8% (45/48) < 0.0001 108.5(33.7–346.3) Allopurinol-tolerant 7.5% (10/133) 0.1547 0.6 (0.3–1.2) General population control 12.1% (34/280) _ From the table, it can be concluded that Allopurinol-induced sCADR have the highest frequency of the allele while the general population control has the lowest.

The figure below shows the limit of detecting TaqMan assay through the serially testing of HLA-B*58:01 DNA (Zhang,2015 pg. 387).

Conclusion From the above study, the development of an assay consisting combinations of SSPs and TaqMan probes in order to find out the presence of HLA- B*58:01 through a single reaction was successful. By investigating the distribution of HLA-B*58:01, and allopurinol-induced sCADR and HLA-B*58:01, the data obtained indicated that it is possible to use HLA-B*58:01as a risk prediction maker before prescribing allopurinol (Zhang,2015 pg. 384).

References Zhang, X., Ma, H., Hu, C., Yu, B., Ma, W., Wu, Z., Luo, X., Zou, H. and Guan, M., 2015. Detection of HLA-B* 58: 01 with TaqMan assay and its association with allopurinol-induced sCADR. Clinical Chemistry and Laboratory Medicine (CCLM), 53(3), pp.383-390. Kang, X., Chen, R., Han, M., Liu, Z., Liu, J., Dai, P., Chen, C. and Wang, H., 2016. Rapid and reliable genotyping of HLA-B* 58: 01 in four Chinese populations using a single-tube duplex real-time PCR assay. Pharmacogenomics, 17(1), pp.47-57.