Translation & Mutations Bio 391 9.5-9.7; 15.4

Translation The mRNA leaves the nucleus  cytoplasm Message is read at the ribosome 1 Codon (3 letter message) is translated into 1 amino acid tRNA molecule has one end (anticodon) that matches the mRNA . Each anticodon specifies an amino acid. The amino acids are bonded together as peptide chains…which fold into proteins Translation

The Genetic Code: 3 letters = 1 codon  1 amino acid http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a3.html

“Charging”  addition of specific amino acid to its tRNA Review tRNA structure “Charging”  addition of specific amino acid to its tRNA 20 different enzymes are involved Requires energy to bind amino acid to tRNA

Ribosome Structure

Three stages: Initiation Elongation Termination http://www.biostudio.com/demo_freeman_protein_synthesis.htm

Translation initiation complex The initiation stage of translation Brings together mRNA, tRNA bearing the first amino acid of the polypeptide, and two subunits of a ribosome Large ribosomal subunit The arrival of a large ribosomal subunit completes the initiation complex. Proteins called initiation factors (not shown) are required to bring all the translation components together. GTP provides the energy for the assembly. The initiator tRNA is in the P site; the A site is available to the tRNA bearing the next amino acid. 2 Initiator tRNA mRNA mRNA binding site Small Translation initiation complex P site GDP GTP Start codon A small ribosomal subunit binds to a molecule of mRNA. In a prokaryotic cell, the mRNA binding site on this subunit recognizes a specific nucleotide sequence on the mRNA just upstream of the start codon. An initiator tRNA, with the anticodon UAC, base-pairs with the start codon, AUG. This tRNA carries the amino acid methionine (Met). 1 Met U A C G E 3 5 Figure 17.17

Elongation Amino acids are added one by one to the preceding amino acid Figure 17.18 Amino end of polypeptide mRNA Ribosome ready for next aminoacyl tRNA E P A GDP GTP 2 site 5 3 TRANSCRIPTION TRANSLATION DNA Ribosome Polypeptide Codon recognition. The anticodon of an incoming aminoacyl tRNA base-pairs with the complementary mRNA codon in the A site. Hydrolysis of GTP increases the accuracy and efficiency of this step. 1 Peptide bond formation. An rRNA molecule of the large subunit catalyzes the formation of a peptide bond between the new amino acid in the A site and the carboxyl end of the growing polypeptide in the P site. This step attaches the polypeptide to the tRNA in the A site. 2 Translocation. The ribosome translocates the tRNA in the A site to the P site. The empty tRNA in the P site is moved to the E site, where it is released. The mRNA moves along with its bound tRNAs, bringing the next codon to be translated into the A site. 3

Termination Ribosome reaches a stop codon in the mRNA Figure 17.19 Release factor Free polypeptide Stop codon (UAG, UAA, or UGA) 5 3 When a ribosome reaches a stop codon on mRNA, the A site of the ribosome accepts a protein called a release factor instead of tRNA. 1 The release factor hydrolyzes the bond between the tRNA in the P site and the last amino acid of the polypeptide chain. The polypeptide is thus freed from the ribosome. 2 3 The two ribosomal subunits and the other components of the assembly dissociate.

Practice with this sequence DNA: 5’TCGATGTTCCGCCGTACGTCGTAACCG 3’AGCTACAAGGCGGCATGCAGCATTGGC Use the bottom strand as the complement to the mRNA.  sense strand (versus antisense strand) Hint: Look for where it starts. How do you know? Once you’ve found the “reading frame”, write in triplets mRNA  Use your genetic code wheel to write the amino acid sequence. How will you know when to stop?

Try again without help DNA: 5’CGTCATGTTCGCGCTACAAATGAAATGA 3’GCAGTACAAGCGCGATGTTTACTTTACT mRNA: Polypeptide:

9.6 Transport and Modification of Proteins The amino acid sequence is only the primary structure of the protein Many proteins still need to be chemically modified and folded, some may need to be cut into segments or have parts removed Transport Proteins meant to function outside of the cell or in the membrane are assembled at the ribosomes on the ER (Why?) A region in the sequence of the protein called signal sequence helps direct the protein Chaperones  “helper” proteins for processes

Protein Folding Amino acids have different properties Some are positively charged, some are negatively charged, some are hydrophilic, hydrophobic or neutral. This affects their interaction within themselves Takahashi and Miller (UCLA, 2007) Used this information to create a musical interpretation of the amino acids http://neurophilosophy.wordpress.com/2007/05/03/transcribe-dna-sequences-into-music/ http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=90903230 Huntington gene

9.7 Translation Errors Most mistakes are caught and corrected Mistakes that can occur: Frameshifts (reading frame is shifted by 1 or 2 nucleotides Can cause wrong AA sequence Can cause early STOP Insufficient supply of needed amino acids

Effects of Mutations in DNA to Protein Synthesis Insertion (cause frameshift) Nucleotide(s) added to sequence Deletion (cause frameshift) Nucleotide(s) skipped in sequence Substitution (usually just alters 1 AA) Correct nucleotide is replaced with incorrect nucleotide

Example of Deletion and Insertion Mutations

Mutations continued…. Sequence Mutations  one or a few bp change Substitutions, deletions, insertaions Point Mutations Missense  change an important a.a. Nonsense  change an a.a. to a stop codon Frameshift Mutations Chromosomal Mutations  larger scale Deletions, duplications, inversions, translocations See handout for more details