Genetic Research and Biotechnology

Slides:



Advertisements
Similar presentations
DNA Fingerprinting and Forensic Analysis Chapter 8.
Advertisements

13-2 Manipulating DNA.
DNA Sequencing How do you do it?. DNA Sequencing DNA sequencing – used to determine the actual DNA sequence of an organism. Using a computer, one can.
DNA Sequencing. ? ? DNA extraction PCR Gel electrophoresis Insect identification ACAGATGTCTTGTAATCCGGC CGTTGGTGGCATAGGGAAAG GACATTTAGTGAAAGAAATTG ATGCGATGGGTGGATCGATG.
DNA Sequencing.
Sanger-Coulson Dideoxynucleotide Sequencing Kwamina Bentsi-Barnes Deisy Mendoza Jennifer Aoki Lecture 10/30/00 Best printed in color for clarity.
7.1 cont’d: Sanger Sequencing SBI4UP MRS. FRANKLIN.
DNA Sequencing. * Sequencing means finding the order of nucleotides on a piece of DNA. * Nucleotide order determines amino acid order, and by extension,
Automated DNA Sequencing LECTURE 7: Biotechnology; 3 Credit hours Atta-ur-Rahman School of Applied Biosciences (ASAB) National University of Sciences and.
DNA Sequencing Today, laboratories routinely sequence the order of nucleotides in DNA. DNA sequencing is done to: Confirm the identity of genes isolated.
1.) DNA Extraction Follow Kit Grind sample Mix with solution and spin Bind, Wash, Elute.
Manipulating DNA Genetic Engineering uses the understanding of the properties of DNA to study and change DNA sequences in living organisms – Invitro… in.
Slide 1 of 32 Copyright Pearson Prentice Hall Biology.
Applications of DNA technology
Manipulating DNA.
A Lot More Advanced Biotechnology Tools (Part 1) Sequencing.
13-1 Changing the Living World
BIOTECH!. Figure DNA fingerprints from a murder case.
GENE SEQUENCING. INTRODUCTION CELL The cells contain the nucleus. The chromosomes are present within the nucleus.
Sequencing by the Sanger Dideoxynucleotide Chain Termination Method 1. Prepare replication template denature, add synthetic primer, promote annealing TAGGCGA.
Manipulating DNA. Scientists use their knowledge of the structure of DNA and its chemical properties to study and change DNA molecules Different techniques.
Advantages of STR Analysis
1 PCR: identification, amplification, or cloning of DNA through DNA synthesis DNA synthesis, whether PCR or DNA replication in a cell, is carried out by.
DNA Sequencing Mimi Chen & Joanne Kim
DNA Sequencing Mimi Chen & Joanne Kim
FOOTHILL HIGH SCHOOL SCIENCE DEPARTMENT Chapter 13 Genetic Engineering Section 13-2 Manipulating DNA.
DNA Sequencing Sanger Di-deoxy method of Sequencing Manual versus Automatic Sequencing.
DNA Sequencing Hunter Jones, Mitchell Gage. What’s the point? In a process similar to PCR, DNA sequencing uses a mixture of temperature changes, enzymes.
End Show Slide 1 of 32 Copyright Pearson Prentice Hall Biology.
Title: Studying whole genomes Homework: learning package 14 for Thursday 21 June 2016.
핵산 염기서열 분석(DNA SEQUENCING)
PCR Polymerase chain reaction. PCR is a method of amplifying (=copy) a target sequence of DNA.
DNA sequencing DNA sequencing is the process of determining the precise order of nucleotides within a DNA molecule. It includes any method or technology.
Gel Electrophoresis Technique for separating DNA molecules based on size Load DNA mixture into gel containing pores of varying sizes Subject DNA to electric.
Ch 15 DNA Technology/ Genetic Engineering
Biogenetic Engineering
DNA Sequencing BCH 446.
Copyright Pearson Prentice Hall
DNA Sequencing Techniques
Di-deoxynucleotide Chain Termination
DNA Sequencing.
Chapter 13.2 Manipulating DNA.
Sequencing Technologies
AMPLIFYING AND ANALYZING DNA.
DNA Technology.
DNA profiling DNA profiling is a technique by which individuals can be identified and compared via their respective DNA profiles. Definitions you will.
The Human Genome Project
DNA Sequence Determination (Sanger)
Screening a Library for Clones Carrying a Gene of Interest
DNA Technology.
Biogenetic Engineering
Biogenetic Engineering
Copyright Pearson Prentice Hall
Sequencing and Copying DNA
Copyright Pearson Prentice Hall
DNA TECHNOLOGY.
A B - deoxynucleotide (dNTP) dideoxynucleotide (ddNTP)
DNA and the Genome Key Area 8a Genomic Sequencing.
Copyright Pearson Prentice Hall
Polymerase Chain Reaction (PCR) & DNA SEQUENCING
Plant Biotechnology Lecture 2
Copyright Pearson Prentice Hall
History of DNA Fingerprinting
Copyright Pearson Prentice Hall
DNA Technology.
Copyright Pearson Prentice Hall
SBI4U0 Biotechnology.
Gel Electrophoresis Technique for separating DNA molecules based on size.
Using the DNA Sequence Knowing the sequence of an organism’s DNA allows researchers to study specific genes, to compare them with the genes of other organisms,
Polymerase Chain Reaction (PCR) & DNA SEQUENCING
Presentation transcript:

Genetic Research and Biotechnology Gel Electophoresis, Polymerase Chain Reaction, and, Dideoxysequencing And STR (short tandem repeats)

Gel Electrophoresis Gel electrophoresis (real life) Uses of gel electrophoresis: DNA fingerprinting (animation) Separating pieces of DNA to isolate them Estimating the size of DNA molecules

Dideoxysequencing (aka the Sanger method) Basic overview This method is used to determine the sequence of bases in a strand of DNA. What is a ddntp? https://www.youtube.com/watch?v=e2G5zx-OJIw How does the process work with using gel electrophoresis? https://www.youtube.com/watch?v=vK-HlMaitnE https://www.youtube.com/watch?v=FvHRio1yyhQ

Dideoxynucleotides

The Method DNA denatured into single strands using heat. Radioactive primer is attached to the template strand. The solution is divided into four tubes labeled "G", "A", "T" and "C". Reagents added as follows: "G" tube: all four dNTP's, ddGTP and DNA polymerase "A" tube: all four dNTP's, ddATP and DNA polymerase "T" tube: all four dNTP's, ddTTP and DNA polymerase "C" tube: all four dNTP's, ddCTP and DNA polymerase 5. Polymerase is then allowed to copy the DNA sequence

Building the New DNA As the DNA is synthesized, nucleotides are added on to the growing chain by the DNA polymerase. Whenever a dideoxynucleotide is added to the chain the DNA sequence ends.

In the “G” tube we might find the following mixture:

Separating the Pieces of new DNA Once these reactions are completed, the DNA is denatured in preparation for electrophoresis. The contents of each of the four tubes are run in separate lanes to separate the different sized bands from one another. Smaller fragments migrate faster across the gel. If all of the reactions from the four tubes are combined on one gel, the actual DNA sequence in the 5' to 3' direction can be determined by reading the banding pattern from the bottom of the gel up. It is important to remember that this sequence is complementary to the template strand you are trying to sequence.

Automated Sequencing More DNA can be sequenced in a shorter period of time. The reactions are performed in a single tube containing all four ddNTP's, each labeled with a different color dye. As in Sanger's method, the DNA is separated on a gel, but they are all run on the same lane as opposed to four different ones.

STR (short tandem repeats) Most of our DNA is identical to the DNA of others However there are regions of our DNA that can vary from person to person The human genome is full of repeating sequences of 2 – 6 bp long (like a genetic stutter) They are found mostly near the centrome of chromosomes STR’s are very useful for DNA analysis in forensic cases and paternity testing Mr Andersen on STR’s https://www.youtube.com/watch?v=DbR9xMXuK7c