Definition of PCR Requirements for PCR PCR Process Agarose gel electrophoresis Primer design

The polymerase chain reaction (PCR) is a technique widely used in molecular biology. It is used to amplify a fragment of DNA by in vitro enzymatic replication. PCR is now a common technique used in medical and biological research labs for a variety of tasks, such as

The sequencing of genes and the diagnosis of hereditary diseases. The identification of genetic fingerprints. The detection and diagnosis of infectious diseases.

DNA template that contains the DNA region to be amplified. One or more primers, which are complementary to the DNA regions at the 5' (five prime) and 3' (three prime) ends of the DNA region. a DNA polymerase such as Taq- polymearase (dNTPs). Buffer solution thermal cycler

1) Denaturation: During denaturation, the template DNA is separated (denatured) into its two separate strands by heating at the temperature about 95º C. 2) Annealing: This involves the annealing of the primer to the denatured DNA. The temperature is lowered to a degree specific for the primer, which generally lies between 40ºC and 68ºC. 3) Extension: The third step, the synthesizing, takes place at a temperature of around 72º C. This corresponds to the optimal temperature for the Taq- polymerase to work.

For visualization of DNA, ethidium bromide is added to DNA to gives a fluorescence, which can be seen under a UV light. Nucleic acids have consistent negative charge imparted by their phosphate backbone, and migrate toward the anode Small fragments of DNA can move more easily through the gel than larger ones and so all the different sizes spread out and separation occurs on the basis of size.

The result

Primer design

Uniqueness one and only one target site in the template DNA where the primer binds, which means the primer sequence shall be unique in the template DNA. Primer candidate 1 5’-TGCTAAGTTG-3’ Primer candidate 2 5’- CAGTCAACTGCTAC-3’ TGCTAAGTTGCAGTCAACTGCTAC Template DNA 5’...TCAACTTAGCATGATCGGGTA...GTAGCAGTTGACTGTACAACTCAGCAA...3’ NOT UNIQUE! UNIQUE! TGCT AGTTG A

General rules for primer design -- Primer and amplicon length  Primer length determines the specificity and significantly affect its annealing to the template  Too short -- low specificity, resulting in non-specific amplification  Too long -- decrease the template-binding efficiency at normal annealing temperature due to the higher probability of forming secondary structures such as hairpins.  Optimal primer length  bp for general applications  Optimal amplicon size  bp for general application, avoid > 3 kb

General rules for primer design -- Melting temperature (T m )  T m is the temperature at which 50% of the DNA duplex dissociates to become single stranded  Determined by primer length, base composition and concentration.  Also affected by the salt concentration of the PCR reaction mix  Working approximation: T m =2(A+T)+4(G+C) (suitable only for 18mer or shorter).  Optimal melting temperature  52°C-- 60°C  T m above 65°C should be generally avoided because of the potential for secondary annealing.  Higher T m (75°C-- 80°C) is recommended for amplifying high GC content targets.  Primer pair T m mismatch  Significant primer pair T m mismatch can lead to poor amplification  Desirable T m difference < 5°C between the primer pair

Base Composition Base composition affects hybridization specificity and melting/annealing temperature. Random base composition is preferred. We shall avoid long (A+T) and (G+C) rich region if possible. Template DNA 5’...TCAACTTAGCATGATCGGGCA...AAGATGCACGGGCCTGTACACAA...3’ GCCCG TGCCCGATCATGCT GCCCG GCCCG CAT T T AT GC

Melting Temperature Melting Temperature, Tm – the temperature at which half the DNA strands are single stranded and half are double-stranded.. Tm is characteristics of the DNA composition; Higher G+C content DNA has a higher Tm due to more bonds.

Annealing Temperature Annealing Temperature, T anneal – the temperature at which primers anneal to the template DNA. It can be calculated from T m.

Internal Structure If primers can anneal to themselves, or anneal to each other rather than anneal to the template, the PCR efficiency will be decreased dramatically. They shall be avoided.

Primer Pair Matching Primers work in pairs – forward primer and reverse primer. Since they are used in the same PCR reaction, it shall be ensured that the PCR condition is suitable for both of them. One critical feature is their annealing temperatures, which shall be compatible with each other. The maximum difference allowed is 3  C. The closer their T anneal are, the better.

Some thoughts on designing primers: 1. primers should be bases in length; 2. base composition should be 50-60% (G+C); 3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming; 4. Tms between o C are preferred; 5. 3'-ends of primers should not be complementary (ie. base pair), as otherwise primer dimers will be synthesised preferentially to any other product; 6. primer self-complementarity (ability to form 2 o structures such as hairpins) should be avoided; 7. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided. (Innis and Gelfand,1991)