CHAPTER 20 PART 3: A LITTLE MORE ADVANCED BIOTECHNOLOGY TOOLS

Slides:



Advertisements
Similar presentations
DNA Technology & Genomics
Advertisements

A Little More Advanced Biotechnology Tools
What do you notice about these phrases?
DNA Technology & Gene Mapping Biotechnology has led to many advances in science and medicine including the creation of DNA clones via recombinant clones,
Manipulating the Genome: DNA Cloning and Analysis 20.1 – 20.3 Lesson 4.8.
1 Review Describe the process scientists use to copy DNA Use Analogies How is genetic engineering like computer programming 2 Review What is a transgenic.
AP Biology Biotechnology today  Genetic Engineering  manipulation of DNA  if you are going to engineer DNA & genes & organisms, then you need.
© SSER Ltd..
Chapter 20: Biotechnology. Essential Knowledge u 3.a.1 – DNA, and in some cases RNA, is the primary source of heritable information (20.1 & 20.2)
MCC BP Based on work by K. Foglia What do you notice about these phrases? radar racecar Madam I’m Adam Able was I ere I saw Elba a man,
AP Biology What do you notice about these phrases? radar racecar Madam I’m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was.
Chapter 20 Notes: DNA Technology. Understanding & Manipulating Genomes 1995: sequencing of the first complete genome (bacteria) 2003: sequencing of the.
DNA Technology & Genomics
Trends in Biotechnology
-The methods section of the course covers chapters 21 and 22, not chapters 20 and 21 -Paper discussion on Tuesday - assignment due at the start of class.
11/1/2009 Biology 11.1 Gene Technology Gene Technology.
Chapter 20 DNA Technology. DNA Cloning  Gene cloning allows scientists to work with small sections of DNA (single genes) in isolation. –Exactly what.
C HAPTER 20 PART 3: A L ITTLE M ORE A DVANCED B IOTECHNOLOGY T OOLS Better Plasmids.
AP Biology Chapter 20. Biotechnology: DNA Technology & Genomics.
How do you identify and clone a gene of interest? Shotgun approach? Is there a better way?
AP Biology Biotechnology Part 3. Bacterial Cloning Process Bacterium Bacterial chromosome Plasmid Gene inserted into plasmid Cell containing gene of interest.
Biotechnology Methods Producing Recombinant DNAProducing Recombinant DNA Locating Specific GenesLocating Specific Genes Studying DNA SequencesStudying.
Biotechnology (Ch.20). A Brave New World TACGCACATTTACGTACGCGGATGCCGCGACT ATGATCACATAGACATGCTGTCAGCTCTAGTAG ACTAGCTGACTCGACTAGCATGATCGATCAGC TACATGCTAGCACACYCGTACATCGATCCTGAC.
Items for tomorrow and beyond: 1) Study/read captions for all figures within Chapter 20 2) Read Section 20.5 (applications of biotechnology) on pp
Plasmids Continued Once we insert the plasmid into the bacteria how do we know its in the bacteria and has the the right gene in it?
19.1 Techniques of Molecular Genetics Have Revolutionized Biology
Gene Technology1 Biotechnology You are only responsible for the material we get through in class End of Chapter questions: Understand: 1,2,4,5,7, Apply:
GENETIC ENGINEERING CHAPTER 20
Genetic Engineering Genetic engineering is also referred to as recombinant DNA technology – new combinations of genetic material are produced by artificially.
AP Biology Biotech Tools Review AP Biology Biotech Tools Review  Recombinant DNA / Cloning gene  restriction enzyme, plasmids,
1 Objectives describe the steps in gene cloning by using plasmid as the vector.
Chapter 20: DNA Technology and Genomics - Lots of different techniques - Many used in combination with each other - Uses information from every chapter.
DNA Technology Ch. 20. The Human Genome The human genome has over 3 billion base pairs 97% does not code for proteins Called “Junk DNA” or “Noncoding.
DNA Technology & Genomics
Chapter 20: Part 1 DNA Cloning and Plasmids
Trends in Biotechnology Constructing and Screening a DNA Library.
Plan A Topics? 1.Making a probiotic strain of E.coli that destroys oxalate to help treat kidney stones in collaboration with Dr. Lucent and Dr. VanWert.
AP Biology Plasmids  Small supplemental circles of DNA  ,000 base pairs  self-replicating  carry extra genes  2-30 genes  genes for antibiotic.
Gene Cloning & Creating DNA Libraries. Клонирование генов Что означает термин «клонирование»? Как происходит клонирование генов? Чем это отличается от.
C HAPTER 20 PART 3: A L ITTLE M ORE A DVANCED B IOTECHNOLOGY T OOLS Better Plasmids.
A Little More Advanced Biotechnology Tools
What do you notice about these phrases?
DNA Technology and Genomics
A Little More Advanced Biotechnology Tools
Figure 20.2 Overview of gene cloning
What do you notice about these phrases?
Biotech Lab Paper Plasmid with an introduction to using restriction digest and transformation.
© SSER Ltd..
Section 3: Gene Technologies in Detail
DNA Technology & Genomics
Chapter 20: DNA Technology and Genomics
DNA Tools & Biotechnology
Biotech Tools Review
Enduring Understandings
Concept 13.1 Recombinant DNA Can Be Made in the Laboratory
What do you notice about these phrases?
Chapter 20 – DNA Technology and Genomics
Chapter 20 Biotechnology.
Chapter 14 Bioinformatics—the study of a genome
Recombinant DNA Technology
CHAPTER 12 DNA Technology and the Human Genome
A Little More Advanced Biotechnology Tools
DNA Tools & Biotechnology
Recombinant DNA Technology
A Little More Advanced Biotechnology Tools
A Little More Advanced Biotechnology Tools
A Little More Advanced Biotechnology Tools
DNA Technology and Genomics
Chapter 20: DNA Technology and Genomics
Presentation transcript:

CHAPTER 20 PART 3: A LITTLE MORE ADVANCED BIOTECHNOLOGY TOOLS Better Plasmids

ENGINEERED PLASMIDS Building custom plasmids restriction enzyme sites antibiotic resistance genes as a selectable marker Selectable marker antibiotic resistance gene on plasmid ampicillin resistance selecting for successful transformation successful uptake of recombinant plasmid EcoRI BamHI HindIII restriction sites How do we know what’s the right combination of genes on a plasmid? Trail and error research work. selectable markers high copy rate convenient restriction sites There are companies that still develop plasmids, patent them & sell them. Biotech companies (ex. New England BioLabs) plasmid ori amp resistance

SELECTION FOR PLASMID UPTAKE Antibiotic becomes a selecting agent only bacteria with the plasmid will grow on antibiotic (ampicillin) plate only transformed bacteria grow all bacteria grow a a a a a a a a a a a a a a a a a LB plate LB/amp plate cloning

NEED TO SCREEN PLASMIDS Need to make sure bacteria have recombinant plasmid restriction sites recombinant plasmid amp resistance broken LacZ gene inserted gene of interest EcoRI all in LacZ gene BamHI HindIII LacZ gene lactose  blue color lactose  white color X plasmid amp resistance origin of replication

SCREENING FOR RECOMBINANT PLASMID Bacteria take up plasmid Functional LacZ gene Bacteria make blue color Bacteria take up recombinant plasmid Non-functional LacZ gene Bacteria stay white color Which colonies do we want?

FINDING YOUR “GENE OF INTEREST” 2007-2008

FINDING YOUR GENE OF INTEREST DNA hybridization find sequence of DNA using a labeled probe short, single stranded DNA molecule complementary to part of gene of interest labeled with radioactive P32 or fluorescent dye heat treat DNA in gel unwinds (denatures) strands wash gel with probe probe hybridizes with denatured DNA G A T C labeled probe genomic DNA C T A G T C A T C

SOUTHERN BLOTTING restriction digest gel electrophoresis blot DNA off of gel onto filter paper expose filter paper to X-ray film wash filter with labeled probe

SOUTHERN BLOTTING Edwin Southern gel of genomic DNA Northern blot: RNA on filter & DNA probe measures gene expression because grabbing mRNA from cell -- only expressed genes Western blot: protein on filter labeled directly gel of genomic DNA Southern blot IDing one gene Southern blot illustration

DNA FINGERPRINTING PCR by DNA probe analysis is used to determine DNA Fingerprinting: 1. DNA treated with restriction enzyme Result : RFLPS 2. Gel electrophoresis 3. Southern blotting 4. Radioactive probe 5. Autoradiography

DNA LIBRARIES Cut up all of nuclear DNA from many cells of an organism restriction enzyme Clone all fragments into many plasmids at same time “shotgun” cloning Create a stored collection of DNA fragments petri dish has a collection of all DNA fragments from the organism

MAKING A DNA LIBRARY 2 1 engineered plasmid with selectable marker & screening system all DNA from many cells of an organism is cut with restriction enzymes gene of interest 3 all DNA fragments inserted into many plasmids human genome = 3 billion bases fragments are cut to ~5000 bases therefore ~ 600,000 fragments per cell. But you have to use many cells to make sure you have a complete set in the library, so… you may have millions of cells that you extracted the DNA from, so… you would need millions of colonies, so the human genome cloned into bacteria would be a walk-in freezer full of petri dishes. 4 clone plasmids into bacteria

? DNA LIBRARY recombinant plasmids inserted into bacteria But how do we find colony with our gene of interest in it? recombinant plasmids inserted into bacteria gene of interest human genome = 3 billion bases fragments are cut to ~5000 bases therefore ~ 600,000 fragments per cell. But you have to use many cells to make sure you have a complete set in the library, so… you may have millions of cells that you extracted the DNA from, so… you would need millions of colonies, so the human genome cloned into bacteria would be a walk-in freezer full of petri dishes. ? DNA Library plate of bacterial colonies storing & copying all genes from an organism (ex. human)

FIND YOUR GENE IN DNA LIBRARY Locate Gene of Interest to find your gene you need some of gene’s sequence if you know sequence of protein… can “guess” part of DNA sequence “back translate” protein to DNA if you have sequence of similar gene from another organism… use part of this sequence Complementation if you have a mutant that lacks YFG, you can transform bacteria with plasmids from the library until one “cures” (complements) the mutation ? Which bacterial colony has our gene? Like a needle in a haystack!

COLONY BLOTS Locate expose film Cloning 4 Locate expose film locate colony on plate from film 1 Cloning - plate with bacterial colonies carrying recombinant plasmids plate plate + filter film 3 2 Replicate plate press filter paper onto plate to take sample of cells from every colony Hybridization - heat filter paper to denature DNA - wash filter paper with radioactive probe which will only attach to gene of interest filter

PROBLEMS… introns Human Genome library Clean up the junk! are there only genes in there? nope! a lot of junk! human genomic library has more “junk” than genes in it Clean up the junk! if you want to clone a human gene into bacteria, you can’t have… introns

HOW DO YOU CLEAN UP THE JUNK? Don’t start with DNA… Use mRNA copy of the gene without the junk! But in the end, you need DNA to clone into plasmid… How do you go from RNA  DNA? reverse transcriptase from RNA viruses retroviruses reverse transcriptase

CDNA (COPY DNA) LIBRARIES Collection of only the coding sequences of expressed genes extract mRNA from cells reverse transcriptase RNA  DNA from retroviruses clone into plasmid Applications need edited DNA for expression in bacteria human insulin Could you imagine how much that first insulin clone was worth to Genentech? One little piece of DNA in a plasmid worth billions! It put them on the map & built a multi-billion dollar biotech company.

DNA RNA protein trait WHERE DO WE GO NEXT…. When a gene is turned on, it creates a trait want to know what gene is being expressed extract mRNA from cells mRNA = active genes How do you match mRNA back to DNA in cells??? reverse transcriptase

MICROARRAYS slide with spots of DNA each spot = 1 gene Create a slide with a sample of each gene from the organism each spot is one gene Convert mRNA  labeled cDNA mRNA  cDNA mRNA from cells reverse transcriptase

MICROARRAYS Labeled cDNA hybridizes with DNA on slide slide with spots of DNA each spot = 1 gene Labeled cDNA hybridizes with DNA on slide each yellow spot = gene matched to mRNA each yellow spot = expressed gene cDNA matched to genomic DNA mRNA  cDNA Developed by Pat Brown at Stanford in late 1980s Realized quickly he needed an automated system: robot spotter Designed spotter & put plans on Internet for benefit of scientific community.

APPLICATION OF MICROARRAYS “DNA CHIP” 2-color fluorescent tagging Comparing treatments or conditions = Measuring change in gene expression sick vs. healthy; cancer vs. normal cells before vs. after treatment with drug different stages in development Color coding: label each condition with different color red = gene expression in one sample green = gene expression in other sample yellow = gene expression in both samples black = no or low expression in both It’s all about comparisons! Powerful research tool.

I may be very selective… But still Ask Questions! 2007-2008 EcoRI BamHI HindIII restriction sites plasmid ori amp resistance