Fig. 20-1 Figure 20.1 How can this array of spots be used to compare normal and cancerous tissues?

Figure 20.2 A preview of gene cloning and some uses of cloned genes Cell containing gene of interest Bacterium 1 Gene inserted into plasmid Bacterial chromosome Plasmid Gene of interest Recombinant DNA (plasmid) DNA of chromosome 2 Plasmid put into bacterial cell Recombinant bacterium 3 Host cell grown in culture to form a clone of cells containing the “cloned” gene of interest Gene of Interest Protein expressed by gene of interest Copies of gene Protein harvested Figure 20.2 A preview of gene cloning and some uses of cloned genes 4 Basic research and various applications Basic research on gene Basic research on protein Gene for pest resistance inserted into plants Gene used to alter bacteria for cleaning up toxic waste Protein dissolves blood clots in heart attack therapy Human growth hor- mone treats stunted growth

Cell containing gene of interest Bacterium Fig. 20-2a Cell containing gene of interest Bacterium 1 Gene inserted into plasmid Bacterial chromosome Plasmid Gene of interest Recombinant DNA (plasmid) DNA of chromosome 2 2 Plasmid put into bacterial cell Figure 20.2 A preview of gene cloning and some uses of cloned genes Recombinant bacterium

Recombinant bacterium Fig. 20-2b Recombinant bacterium 3 Host cell grown in culture to form a clone of cells containing the “cloned” gene of interest Gene of Interest Protein expressed by gene of interest Copies of gene Protein harvested 4 Basic research and various applications Basic research on gene Basic research on protein Figure 20.2 A preview of gene cloning and some uses of cloned genes Gene for pest resistance inserted into plants Gene used to alter bacteria for cleaning up toxic waste Protein dissolves blood clots in heart attack therapy Human growth hor- mone treats stunted growth

Restriction enzyme cuts sugar-phosphate backbones. Fig. 20-3-1 Restriction site DNA 5 3 3 5 1 Restriction enzyme cuts sugar-phosphate backbones. Sticky end Figure 20.3 Using a restriction enzyme and DNA ligase to make recombinant DNA

Restriction enzyme cuts sugar-phosphate backbones. Fig. 20-3-2 Restriction site DNA 5 3 3 5 1 Restriction enzyme cuts sugar-phosphate backbones. Sticky end 2 DNA fragment added from another molecule cut by same enzyme. Base pairing occurs. Figure 20.3 Using a restriction enzyme and DNA ligase to make recombinant DNA One possible combination

Restriction enzyme cuts sugar-phosphate backbones. Fig. 20-3-3 Restriction site DNA 5 3 3 5 1 Restriction enzyme cuts sugar-phosphate backbones. Sticky end 2 DNA fragment added from another molecule cut by same enzyme. Base pairing occurs. Figure 20.3 Using a restriction enzyme and DNA ligase to make recombinant DNA One possible combination 3 DNA ligase seals strands. Recombinant DNA molecule

Fig. 20-4-1 TECHNIQUE Hummingbird cell Bacterial cell lacZ gene Restriction site Sticky ends Gene of interest ampR gene Bacterial plasmid Hummingbird DNA fragments Figure 20.4 Cloning genes in bacterial plasmids

Fig. 20-4-2 TECHNIQUE Hummingbird cell Bacterial cell lacZ gene Restriction site Sticky ends Gene of interest ampR gene Bacterial plasmid Hummingbird DNA fragments Nonrecombinant plasmid Recombinant plasmids Figure 20.4 Cloning genes in bacterial plasmids

Fig. 20-4-3 TECHNIQUE Hummingbird cell Bacterial cell lacZ gene Restriction site Sticky ends Gene of interest ampR gene Bacterial plasmid Hummingbird DNA fragments Nonrecombinant plasmid Recombinant plasmids Bacteria carrying plasmids Figure 20.4 Cloning genes in bacterial plasmids

Fig. 20-4-4 TECHNIQUE Hummingbird cell Bacterial cell lacZ gene Restriction site Sticky ends Gene of interest ampR gene Bacterial plasmid Hummingbird DNA fragments Nonrecombinant plasmid Recombinant plasmids Bacteria carrying plasmids Figure 20.4 Cloning genes in bacterial plasmids RESULTS Colony carrying non- recombinant plasmid with intact lacZ gene Colony carrying recombinant plasmid with disrupted lacZ gene One of many bacterial clones

Fig. 20-5 Foreign genome cut up with restriction enzyme Large insert with many genes Large plasmid or BAC clone Recombinant phage DNA Bacterial clones Recombinant plasmids Phage clones Figure 20.5 Genomic libraries (a) Plasmid library (b) Phage library (c) A library of bacterial artificial chromosome (BAC) clones

Foreign genome cut up with restriction enzyme Fig. 20-5a Foreign genome cut up with restriction enzyme or Recombinant phage DNA Bacterial clones Recombinant plasmids Phage clones Figure 20.5a, b Genomic libraries (a) Plasmid library (b) Phage library

Large insert with many genes Large plasmid Fig. 20-5b Large insert with many genes Large plasmid BAC clone Figure 20.5c Genomic libraries (c) A library of bacterial artificial chromosome (BAC) clones

DNA in nucleus mRNAs in cytoplasm Fig. 20-6-1 Figure 20.6 Making complementary DNA (cDNA) for a eukaryotic gene

Reverse transcriptase Poly-A tail mRNA Fig. 20-6-2 DNA in nucleus mRNAs in cytoplasm Reverse transcriptase Poly-A tail mRNA DNA strand Primer Figure 20.6 Making complementary DNA (cDNA) for a eukaryotic gene

Reverse transcriptase Poly-A tail mRNA Fig. 20-6-3 DNA in nucleus mRNAs in cytoplasm Reverse transcriptase Poly-A tail mRNA DNA strand Primer Degraded mRNA Figure 20.6 Making complementary DNA (cDNA) for a eukaryotic gene

Reverse transcriptase Poly-A tail mRNA Fig. 20-6-4 DNA in nucleus mRNAs in cytoplasm Reverse transcriptase Poly-A tail mRNA DNA strand Primer Degraded mRNA Figure 20.6 Making complementary DNA (cDNA) for a eukaryotic gene DNA polymerase

Reverse transcriptase Poly-A tail mRNA Fig. 20-6-5 DNA in nucleus mRNAs in cytoplasm Reverse transcriptase Poly-A tail mRNA DNA strand Primer Degraded mRNA Figure 20.6 Making complementary DNA (cDNA) for a eukaryotic gene DNA polymerase cDNA

For example, if the desired gene is A probe can be synthesized that is complementary to the gene of interest For example, if the desired gene is – Then we would synthesize this probe … … 5 G G C T A A C T T A G C 3 3 C C G A T T G A A T C G 5

Radioactively labeled probe molecules Fig. 20-7 TECHNIQUE Radioactively labeled probe molecules Probe DNA Gene of interest Multiwell plates holding library clones Single-stranded DNA from cell Film • Figure 20.7 Detecting a specific DNA sequence by hybridizing with a nucleic acid probe Nylon membrane Nylon membrane Location of DNA with the complementary sequence

molecules; 2 molecules (in white boxes) match target sequence Fig. 20-8 TECHNIQUE 5 3 Target sequence Genomic DNA 3 5 1 Denaturation 5 3 3 5 2 Annealing Cycle 1 yields 2 molecules Primers 3 Extension New nucleo- tides Figure 20.8 The polymerase chain reaction (PCR) Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence

TECHNIQUE 5 3 Target sequence Genomic DNA 3 5 Fig. 20-8a Figure 20.8 The polymerase chain reaction (PCR)

Cycle 1 yields 2 molecules Fig. 20-8b 1 Denaturation 5 3 3 5 2 Annealing Cycle 1 yields 2 molecules Primers 3 Extension Figure 20.8 The polymerase chain reaction (PCR) New nucleo- tides

Cycle 2 yields 4 molecules Fig. 20-8c Cycle 2 yields 4 molecules Figure 20.8 The polymerase chain reaction (PCR)

molecules; 2 molecules (in white boxes) match target sequence Fig. 20-8d Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence Figure 20.8 The polymerase chain reaction (PCR)

Figure 20.9 Gel electrophoresis TECHNIQUE Mixture of DNA mol- ecules of different sizes Power source – Cathode Anode + Gel 1 Power source – + Longer molecules 2 Shorter molecules RESULTS Figure 20.9 Gel electrophoresis

Mixture of DNA mol- ecules of different sizes Fig. 20-9a TECHNIQUE Power source Mixture of DNA mol- ecules of different sizes – Cathode Anode + Gel 1 Power source Figure 20.9 Gel electrophoresis – + Longer molecules 2 Shorter molecules

Fig. 20-9b RESULTS Figure 20.9 Gel electrophoresis

Fig. 20-10 Normal -globin allele Normal allele Sickle-cell allele 175 bp 201 bp Large fragment DdeI DdeI DdeI DdeI Large fragment Sickle-cell mutant -globin allele 376 bp 201 bp 175 bp 376 bp Large fragment DdeI Figure 20.10 Using restriction fragment analysis to distinguish the normal and sickle-cell alleles of the β-globin gene DdeI DdeI (a) DdeI restriction sites in normal and sickle-cell alleles of -globin gene (b) Electrophoresis of restriction fragments from normal and sickle-cell alleles

Fig. 20-11 TECHNIQUE Heavy weight Restriction fragments DNA + restriction enzyme I II III Nitrocellulose membrane (blot) Gel Sponge I Normal -globin allele II Sickle-cell allele III Heterozygote Paper towels Alkaline solution 1 Preparation of restriction fragments 2 Gel electrophoresis 3 DNA transfer (blotting) Radioactively labeled probe for -globin gene Figure 20.11 Southern blotting of DNA fragments Probe base-pairs with fragments I II III I II III Fragment from sickle-cell -globin allele Film over blot Fragment from normal -globin allele Nitrocellulose blot 4 Hybridization with radioactive probe 5 Probe detection

Restriction fragments DNA + restriction enzyme I II III Fig. 20-11a TECHNIQUE Heavy weight Restriction fragments DNA + restriction enzyme I II III Nitrocellulose membrane (blot) Gel Sponge I Normal -globin allele II Sickle-cell allele III Heterozygote Paper towels Alkaline solution Figure 20.11 Southern blotting of DNA fragments 1 Preparation of restriction fragments 2 Gel electrophoresis 3 DNA transfer (blotting)

Radioactively labeled probe for -globin gene Fig. 20-11b Radioactively labeled probe for -globin gene Probe base-pairs with fragments I II III I II III Fragment from sickle-cell -globin allele Film over blot Figure 20.11 Southern blotting of DNA fragments Fragment from normal -globin allele Nitrocellulose blot 4 Hybridization with radioactive probe 5 Probe detection

Figure 20.12 Dideoxy chain termination method for sequencing DNA TECHNIQUE DNA (template strand) Primer Deoxyribonucleotides Dideoxyribonucleotides (fluorescently tagged) dATP ddATP dCTP ddCTP DNA polymerase dTTP ddTTP dGTP ddGTP DNA (template strand) Labeled strands Shortest Longest Direction of movement of strands Longest labeled strand Figure 20.12 Dideoxy chain termination method for sequencing DNA Detector Laser Shortest labeled strand RESULTS Last base of longest labeled strand Last base of shortest labeled strand

Fig. 20-12a TECHNIQUE DNA (template strand) Primer Deoxyribonucleotides Dideoxyribonucleotides (fluorescently tagged) dATP ddATP dCTP ddCTP dTTP DNA polymerase ddTTP dGTP ddGTP Figure 20.12 Dideoxy chain termination method for sequencing DNA

Direction of movement of strands Longest labeled strand Fig. 20-12b TECHNIQUE DNA (template strand) Labeled strands Shortest Longest Direction of movement of strands Longest labeled strand Detector Figure 20.12 Dideoxy chain termination method for sequencing DNA Laser Shortest labeled strand RESULTS Last base of longest labeled strand Last base of shortest labeled strand

TECHNIQUE 1 cDNA synthesis mRNAs cDNAs Primers 2 -globin gene 3 Fig. 20-13 TECHNIQUE 1 cDNA synthesis mRNAs cDNAs Primers 2 PCR amplification -globin gene 3 Gel electrophoresis Figure 20.13 RT-PCR analysis of expression of single genes Embryonic stages RESULTS 1 2 3 4 5 6

Fig. 20-14 Figure 20.14 Determining where genes are expressed by in situ hybridization analysis 50 µm

Labeled cDNA molecules (single strands) Fig. 20-15 TECHNIQUE Tissue sample 1 Isolate mRNA. 2 Make cDNA by reverse transcription, using fluorescently labeled nucleotides. mRNA molecules Labeled cDNA molecules (single strands) 3 Apply the cDNA mixture to a microarray, a different gene in each spot. The cDNA hybridizes with any complementary DNA on the microarray. DNA fragments representing specific genes Figure 20.15 DNA microarray assay of gene expression levels DNA microarray DNA microarray with 2,400 human genes 4 Rinse off excess cDNA; scan microarray for fluorescence. Each fluorescent spot represents a gene expressed in the tissue sample.

EXPERIMENT RESULTS Transverse section of carrot root 2-mg fragments Fig. 20-16 EXPERIMENT RESULTS Transverse section of carrot root 2-mg fragments Figure 20.16 Can a differentiated plant cell develop into a whole plant? Fragments were cultured in nu- trient medium; stirring caused single cells to shear off into the liquid. Single cells free in suspension began to divide. Embryonic plant developed from a cultured single cell. Plantlet was cultured on agar medium. Later it was planted in soil. A single somatic carrot cell developed into a mature carrot plant.

EXPERIMENT RESULTS Frog embryo Frog egg cell Frog tadpole UV Fig. 20-17 Frog embryo Frog egg cell Frog tadpole EXPERIMENT UV Fully differ- entiated (intestinal) cell Less differ- entiated cell Donor nucleus trans- planted Donor nucleus trans- planted Enucleated egg cell Egg with donor nucleus activated to begin development RESULTS Figure 20.17 Can the nucleus from a differentiated animal cell direct development of an organism? Most develop into tadpoles Most stop developing before tadpole stage

TECHNIQUE RESULTS Mammary cell donor Egg cell donor Fig. 20-18 TECHNIQUE Mammary cell donor Egg cell donor 1 2 Egg cell from ovary Nucleus removed Cultured mammary cells 3 Cells fused 3 Nucleus from mammary cell 4 Grown in culture Early embryo Figure 20.18 Reproductive cloning of a mammal by nuclear transplantation For the Discovery Video Cloning, go to Animation and Video Files. 5 Implanted in uterus of a third sheep Surrogate mother 6 Embryonic development Lamb (“Dolly”) genetically identical to mammary cell donor RESULTS

Fig. 20-19 Figure 20.19 CC, the first cloned cat, and her single parent

From bone marrow in this example Fig. 20-20 Embryonic stem cells Adult stem cells Early human embryo at blastocyst stage (mammalian equiva- lent of blastula) From bone marrow in this example Cells generating all embryonic cell types Cells generating some cell types Cultured stem cells Different culture conditions Figure 20.20 Working with stem cells Different types of differentiated cells Liver cells Nerve cells Blood cells

Disease-causing allele Fig. 20-21 DNA T Normal allele SNP C Figure 20.21 Single nucleotide polymorphisms (SNPs) as genetic markers for disease-causing alleles Disease-causing allele

Insert RNA version of normal allele into retrovirus. Fig. 20-22 Cloned gene 1 Insert RNA version of normal allele into retrovirus. Viral RNA 2 Let retrovirus infect bone marrow cells that have been removed from the patient and cultured. Retrovirus capsid 3 Viral DNA carrying the normal allele inserts into chromosome. Bone marrow cell from patient Figure 20.22 Gene therapy using a retroviral vector Bone marrow 4 Inject engineered cells into patient.

Fig. 20-23 Figure 20.23 Goats as “pharm” animals

Fig. 20-23a Figure 20.23 Goats as “pharm” animals

Fig. 20-23b Figure 20.23 Goats as “pharm” animals

Fig. 20-24 (a) This photo shows Earl Washington just before his release in 2001, after 17 years in prison. Source of sample STR marker 1 STR marker 2 STR marker 3 Figure 20.24 STR analysis used to release an innocent man from prison For the Discovery Video DNA Forensics, go to Animation and Video Files. Semen on victim 17, 19 13, 16 12, 12 Earl Washington 16, 18 14, 15 11, 12 Kenneth Tinsley 17, 19 13, 16 12, 12 (b) These and other STR data exonerated Washington and led Tinsley to plead guilty to the murder.

Agrobacterium tumefaciens Fig. 20-25 TECHNIQUE Agrobacterium tumefaciens Ti plasmid Site where restriction enzyme cuts T DNA RESULTS DNA with the gene of interest Figure 20.25 Using the Ti plasmid to produce transgenic plants For the Cell Biology Video Pronuclear Injection, go to Animation and Video Files. For the Discovery Video Transgenics, go to Animation and Video Files. Recombinant Ti plasmid Plant with new trait

DNA fragments from genomic DNA or cDNA or copy of DNA obtained by PCR Fig. 20-UN3 DNA fragments from genomic DNA or cDNA or copy of DNA obtained by PCR Vector Cut by same restriction enzyme, mixed, and ligated Recombinant DNA plasmids

TCCATGAATTCTAAAGCGCTTATGAATTCACGGC AGGTACTTAAGATTTCGCGAATACTTAAGTGCCG Fig. 20-UN4 5 TCCATGAATTCTAAAGCGCTTATGAATTCACGGC 3 3 AGGTACTTAAGATTTCGCGAATACTTAAGTGCCG 5 Aardvark DNA G A A T T C T T A C A G Plasmid

Fig. 20-UN5

Fig. 20-UN6

Fig. 20-UN7

You should now be able to: Describe the natural function of restriction enzymes and explain how they are used in recombinant DNA technology Outline the procedures for cloning a eukaryotic gene in a bacterial plasmid Define and distinguish between genomic libraries using plasmids, phages, and cDNA Describe the polymerase chain reaction (PCR) and explain the advantages and limitations of this procedure

Explain how gel electrophoresis is used to analyze nucleic acids and to distinguish between two alleles of a gene Describe and distinguish between the Southern blotting procedure, Northern blotting procedure, and RT-PCR Distinguish between gene cloning, cell cloning, and organismal cloning Describe how nuclear transplantation was used to produce Dolly, the first cloned sheep

Describe the application of DNA technology to the diagnosis of genetic disease, the development of gene therapy, vaccine production, and the development of pharmaceutical products Define a SNP and explain how it may produce a RFLP Explain how DNA technology is used in the forensic sciences

Discuss the safety and ethical questions related to recombinant DNA studies and the biotechnology industry