Email; info@clinicatanaka.jp Type I collagen production stimulation of water-filtered near-infrared shown through gene expression changes in a 3-dimensional human epidermal tissue model Yohei Tanaka, M.D.,Ph.D. Clinica Tanaka Plastic, Reconstructive Surgery and Anti-aging Center, 390-0874, Nagano, Japan Email; info@clinicatanaka.jp Results: A DNA microarray with over 50,000 different probes showed 18 genes that were up- or down-regulated by at least 2-fold after irradiation. Quantitative real-time PCR revealed that, relative to control cells, the gene encoding La ribonucleoprotein domain family member 6 (LARP6), which regulates collagen expression, was significantly up-regulated after 5 and 10 rounds of NIR irradiation at 10 J ⁄cm2 compared to the control (p < 0.05). Statistically significant changes between 5 and 10 rounds were also observed (p < 0.05). Since LARP6 coordinates the efficient translation of COL1A1 and COL1A2 and COL1A1 plays an important role in type I collagen production, I also performed quantitative real-time PCR analysis of COL1A1, which was significantly up-regulated after 5 and 10 rounds of NIR irradiation at 10 J ⁄cm2 relative to untreated control cells (p < 0.05), and there was no statistically significant difference seen between 5 and 10 rounds of exposure (p = 0.8273), as shown in Figure 2. Conclusion: This study provides an objective assessment of gene expression changes induced by water-filtered broad-spectrum near-infrared, and demonstrates its ability to stimulate type I collagen production, which is beneficial for skin rejuvenation applications. Background: Water-filtered broad-spectrum near-infrared (NIR) treatment can provide safe, consistent, and long-term effects for skin rejuvenation, as my previous clinical, histological, and biochemical investigations showed. However, there are few studies that examined changes in gene expression induced. Materials and Methods: NIR treatment. Near-infrared device emits broad spectrum 1000-1800 nm near-infrared together with a water-filter that excludes wavelengths 1400-1500 nm (Titan; Cutera, Brisbane, CA, USA) was used, as shown in Figure 1. Epidermal Model. A commercially available multilayered 3-dimensional cultured human epidermal tissue culture model (LabCyte EPI-MODEL, Japan Tissue Engineering Corporation, Aichi, Japan) was used as an in vitro model of epidermal tissue. Methods: DNA microarray and quantitative real-time PCR analysis was used to assess gene expression levels. Primers for LARP6, COL1A1, and GAPDH are shown in Table 1. Figure 1. NIR treatment for 3-dimensional cultured human epidermal tissue model. Probe Name Gene Name Systematic Name Forward primer Reverse primer A_23_P117782 LARP6 NM_018357 GCAAGTAGCTAAGCCTATAGC CTTGACAGGTAACATCGATTTGG A_33_P3304668 COL1A1 NM_000088 TGGGAGGAAGCAAAAGACTC GGGTCATTTCCACATGCTTT A_23_P13899 GAPDH NM_002046 ACCTGCCGTCTAGAAAAACCTG GTGTCGCTGTTGAAGTCAGAGG Figure 2. Quantitative real-time PCR validation of LARP6 and COL1A1expression. Fold-change in expression was calculated by setting the median value of expression seen in the control to 1.0. Data are shown as the mean ± SEM. (n=3) *p < 0.05. Table 1. LARP6, COL1A1, and GAPDH primers used for quantitative real-time PCR analysis.