Lecture 6 January 12, 2016 Biotech 3.

Slides:



Advertisements
Similar presentations
Recombinant DNA prepare foreign (target) DNA prepare vector (host)
Advertisements

Section H Cloning Vectors
DNA Technology & Gene Mapping Biotechnology has led to many advances in science and medicine including the creation of DNA clones via recombinant clones,
Lecture 3 Chapter 4 Molecular Cloning Methods
Dolly the sheep ( ) 1. Animal and human cloning 2. Gene cloning.
Recombinant DNA Technology. Recombinant DNA Technology combines DNA from different sources – usually different species Utility: this is done to study.
Biotechnology and Genetic Engineering PBIO 4500/5500 Eukaryotic gene organization Restriction enzymes Cloning vectors.
Recombinant DNA and Cloning Riyanda N G (10198) Vina E A (10221) Arini N (10268) Suluh N (10302)
Recombinant DNA Introduction to Recombinant DNA technology
MCB 720: Molecular Biology Eukaryotic gene organization Restriction enzymes Cloning vectors.
Cloning:Recombinant DNA
MCB 720: Molecular Biology
Plasmids and Vectors Instructor Supplement to pGlo Bacterial Transformation.
Lec#3: Recombinant DNA technology-part 2
Molecular Cloning: Construction of a recombinant DNA
Cloning into Plasmids Restriction Fragment Cloning & PCR Cloning by the Topo TA™ Method.
Lecture 3 Lecture 2 catch up Vector structure Copy number control
7.1 Techniques for Producing and Analyzing DNA SBI4UP MRS. FRANKLIN.
Concept 20.1: DNA cloning yields multiple copies of a gene or other DNA segment To work directly with specific genes, scientists prepare well-defined segments.
GENETIC ENGINEERING (RECOMBINANT DNA TECHNOLOGY)
Chapter 9 – DNA-Based Information Technologies
Trends in Biotechnology
Restriction enzymes (endonucleases)
TYPES OF CLONING VECTORS
Cloning and rDNA (II) Dr. Abdulaziz Almalik
1 Genetics Faculty of Agriculture Instructor: Dr. Jihad Abdallah Topic 13:Recombinant DNA Technology.
Yeast as a Model System MBIOS 520/420 September 29, 2005.
TOPICS IN (NANO) BIOTECHNOLOGY Lecture 6 30th October, 2006 PhD Course.
Recombinant DNA I Basics of molecular cloning Polymerase chain reaction cDNA clones and screening.
Molecular Basis for Relationship between Genotype and Phenotype DNA RNA protein genotype function organism phenotype DNA sequence amino acid sequence transcription.
DNA Cloning and PCR.
Molecular Genetics Techniques BIT 220 Chapter 20.
Recombinant DNA Technology Prof. Elena A. Carrasquillo Chapter 4 Molecular Biotechnology Lecture 4.
Cell-based DNA Cloning
PHARMACOBIOTECHNOLOGY.  Recombinant DNA (rDNA) is constructed outside the living cell using enzymes called “restriction enzymes” to cut DNA at specific.
Lecture # 04 Cloning Vectors.
Molecular Biology II Lecture 1 OrR. Restriction Endonuclease (sticky end)
Copyright © 2009 Pearson Education, Inc. Head Tail fiber DNA Tail.
Relationship between Genotype and Phenotype
Cloning Vectors Enable DNA molecules to be replicated inside host (e.g., bacteria) cells. Features: 1. Origin of replication (ORI) 2. Cloning sites =
CLONING VECTORS Shumaila Azam. IMPORTANT CLONING VECTORS.
Fundamentals of Genetic Engineering. 2 2 What are vectors? Vectors are DNA molecules that act as destination for GOI. Vectors act as a vehicle to ultimately.
Molecular Basis for Relationship between Genotype and Phenotype DNA RNA protein genotype function organism phenotype DNA sequence amino acid sequence transcription.
Genetics: Analysis and Principles Robert J. Brooker CHAPTER 18 RECOMBINANT DNA TECHNOLOGY.
VECTORS: TYPES AND CHARACTERISTICS
Topics to be covers Basic features present on plasmids
E.Coli AS MODERN VECTOR.
Gene Cloning Techniques for gene cloning enable scientists to prepare multiple identical copies of gene-sized pieces of DNA. Most methods for cloning pieces.
Lecture# 2 Recombinant DNA technology
Control of Gene Expression in Prokaryotes
Molecular Genetic Analysis and Biotechnology
Fundamental of Biotechnology
Chapter 4 Recombinant DNA Technology
Fac. of Agriculture, Assiut Univ.
Cloning DNA Sequences that Encode Eukaryotic Protein
GENETIC ENGINEERING College of Science/ biology department
Molecular Cloning.
Gene Isolation and Manipulation
Relationship between Genotype and Phenotype
Material for Quiz 5: Chapter 8
Chapter 20 Biotechnology.
Presentation Topic Cloning Vector and its Types Presented By
CLONING VECTORS Shumaila Azam.
Gene Expression 1. Gene expression is the activation of a gene that results in transcription and the production of mRNA. Only a fraction of any cell’s.
Controlling Gene Expression
710.LC GRADUATE MOLECULAR BIOLOGY 9/15/2010
DNA Recombinant Technology
DNA Technology and Genomics
Relationship between Genotype and Phenotype
E.Coli AS MODERN VECTOR.
Presentation transcript:

Lecture 6 January 12, 2016 Biotech 3

Lecture Topics Cloning Vectors Plasmids Bacteriophage Cosmids BACS and YACs 3. PCR General overview and History: 1983 Kary Mullis Mathematical concept and cycle number Polymerase rate and fidelity Forward and Reverse Primer design Affinity tags Tm Secondary structure Primer design for point mutations PCR Parameters: DNA sequence, primers, type of polymerase, melting temperature, extension time, number of cycles 2. Plasmids Origin of Replication Selectivity Markers Multiple Cloning Site Promoter Sequence

A. Cloning Vectors Cloning vector: small piece of DNA that can be stably maintained in an organism and which a foreign piece of DNA can be inserted for cloning purposes. Examples: Plasmids Bacteriophage Cosmids Bacterial Artificial Chromosomes (BAC) Yeast Artificial Chromosomes (YAC)

Plasmids Plasmid: Small circular DNA that can replicate independently from a host’s chromosome. Characteristics: Smaller than chromosome (<1/20th the size) Contain “non-essential genes” Size varies 1 kb – 12,000 kb Copy number is variable (1 – 200 copies per cell depending on the plasmid) Some can integrate into the chromosome Cloning vectors can carry up to ~15 kb We’ll break down the anatomy of a plasmid cloning vector shortly!

Bacteriophage Bacteriophage: A virus that infects and replicates within a bacterium. Examples: λ phage, T2, T4, T7, T Characteristics: Head Collar Tail Tail fibers Base plate 50 kb Approximately 10 – 25 kb can be replaced, up to 45 kb

Bacteriophage Vector

Select for antibiotic resistance Cosmid Vector Cosmids: Plasmid vectors that contain foreign DNA plus only cos sites Characteristics: - Hybrid between phage and plasmid - Approximately 25 - 45 kb can be replaced Select for antibiotic resistance

BAC and YAC Vectors Bacterial Artificial Chromosome (BAC): Based on the 7 kb F factor of E. coli Can carry 100 – 300 kb Yeast Artificial Chromosome (YAC): Very high carrying capacity; up to 1000 kb Resemble normal yeast chromosome: Telomeres, centromere Yeast as a host (not E. coli as previous examples)

Cloning Vector Comparison Cloning Capacity Plasmids 15 kb lambda Phage 10 – 25 kb Cosmid 45 kb BAC 100 – 300 kb YAC 1000 kb

Plasmid vector -1 Features: 1. Origin of replication (Ori) Recognition site for DNA Polymerase Determines copy number (1 to >1,000) “Relaxed” control via RNA “Stringent” control via proteins 2. Selectivity marker Resistance to antibiotic (ex. B-lactamases that break down ampicillin and penicillin 3. Multiple cloning site (MCS) Unique restriction enzyme recognition sites Downstream of promoter sequence 4. Promoter sequence Upstream of the coding region Landing site for RNA polymerase so that the gene can be transcribed into mRNA

Incompatibility Group Plasmid Vector - 2 Features: 1. Origin of replication (Ori) Recognition site for DNA Polymerase Determines copy number (1 to >1,000) “Relaxed” control via RNA “Stringent” control via proteins Common Vectors Copy Number+ ORI Incompatibility Group Control pUC ~500-700 pMB1 (derivative) A Relaxed pBR322 ~15-20 pMB1 pET pGEX pColE1 ColE1 pR6K R6K B Stringent pACYC ~10 p15A pSC101 ~5 C pBluescript ~300-500 ColE1 (derivative) and F1 pGEM pUC and F1 2. Selectivity marker Resistance to antibiotic (ex. B-lactamases that break down ampicillin and penicillin 3. Multiple cloning site (MCS) Unique restriction enzyme recognition sites Downstream of promoter sequence Source: http://blog.addgene.org/plasmid-101-origin-of-replication How to choose? Will plasmid be exclusively used in E. coli? Wil you have more than one plasmid? Do you need a high copy number? Will your gene product be toxic? Decision depends on copy number desired, host or hosts intended, compatibility. Plasmids from same group shouldn’t be co-transformed because they compete for the same machinery 4. Promoter sequence Upstream of the coding region Landing site for RNA polymerase so that the gene can be transcribed into mRNA

Working concentration Plasmid Vector - 3 Features: 1. Origin of replication (Ori) Recognition site for DNA Polymerase Determines copy number (1 to >1,000) “Relaxed” control via RNA “Stringent” control via proteins Name Class Mode of Action Working concentration Kanamycin Aminoglycoside Binds 30S ribosomal subunit, causes mistranslation 50-100 μg/ml Spectinomycin Binds 30S ribosomal subunit, interrupts protein synthesis 7.5-50 μg/ml Ampicillin Beta-lactam Inhibits cell wall synthesis 100-200 μg/ml Erythromycin Macrolide Blocks 50S ribosomal subunit, inhibits aminoacyl translocation 50-100 μg/ml in Ethanol Tetracycline tetracyclin Binds 30S ribosomal subunit, inhibits protein synthesis (elongation step) 10 μg/ml Chloramphenicol Binds 50S ribosomal subunit, inhibits peptidyl translocation 5-25 μg/ml in Ethanol 2. Selectivity marker Resistance to antibiotic (ex. β-lactamases that inhibit cell wall; ampicillin and penicillin) 3. Multiple cloning site (MCS) Unique restriction enzyme recognition sites Downstream of promoter sequence 4. Promoter sequence Upstream of the coding region Landing site for RNA polymerase so that the gene can be transcribed into mRNA Use fresh stocks! Antibiotics break down over time! Store at -20 °C Know which diluent to use; water or ethanol? Do not add to hot media There may be more than one!

Antibiotics Targets DNA Replication (Quinolones – Ciprofloxacin) Metabolism (Sulfonamides - Trimethoprim) Cell Wall (β-lactams – Penicillin Glycopeptides - Vancomycin) Protein Synthesis (Tetracyclines, Macrolides - Erythromycin Aminoglycosides - Neomycin)

Plasmid Vector - 4 Features: 1. Origin of replication (Ori) Recognition site for DNA Polymerase Determines copy number (1 to >1,000) “Relaxed” control via RNA “Stringent” control via proteins 2. Selectivity marker Resistance to antibiotic (ex. B-lactamases that break down ampicillin and penicillin 3. Multiple cloning site (MCS) Unique restriction enzyme recognition sites Downstream of promoter sequence 4. Promoter sequence Upstream of the coding region Landing site for RNA polymerase so that the gene can be transcribed into mRNA Source: Novagen

Plasmid vector -5 pMB1 pBR322 (LacR Binding site) Shine-Dalgarno sequence

Plasmid vector - 6 Features: 1. Origin of replication (Ori) Recognition site for DNA Polymerase Determines copy number (1 to >1,000) “Relaxed” control via RNA “Stringent” control via proteins 2. Selectivity marker Resistance to antibiotic (ex. B-lactamases that break down ampicillin and penicillin 3. Multiple cloning site (MCS) Unique restriction enzyme recognition sites Downstream of promoter sequence 4. Promoter sequence Upstream of the coding region Landing site for RNA polymerase so that the gene can be transcribed into mRNA

Plasmids vector - 7 pMB1 pBR322 (LacR Binding site) Shine-Dalgarno sequence Shine-Dalgarno sequence

β-galactosidase β-galactosidase Oxidation Dimerization β-galactosidase 5-Bromo-4-Chloro-3-indoyl-β-D-galactopyranoside (X-gal) 5-Bromo-6-Chloro-3-indoxyl 5,5'-dibromo-4,4'-dichloro-indigo Absorbs at 615 nm Blue Precipitate β-galactosidase β-D-galactose o-Nitrophenol Orthonitrophenalgalctopyranoside (ONPG)

βlue-White Colony Screen -1

βlue-White Colony Screen -2 X-gal + IPTG plates

Catabolite Repression β-galactosidase In the presence of glucose, a cell does not need β-galactosidase Secondary energy source Primary energy source

Lac Operon lac Z – β-galactosidase lacY – Permease lacA – Transacetylase lacI – Lac Repressor lacO – Operator – site on DNA to which the repressor binds lacP – Promoter – site where RNA Polymerase binds

Isopropyl –D – 1 – thiogalactoside Lac Operon Inducers Isopropyl –D – 1 – thiogalactoside (IPTG) IPTG E. Coli using this type of induction system has a deletion of the lacZ gene

Lac Repressor Binding site (Operator) Plasmids vector Lac Repressor Binding site (Operator) Blue-White Screen pMB1 pBR322 Shine-Dalgarno sequence

T7 Promoter Sequence from the T7 bacteriophage T7 Polymerase is under control of the lac promoter Expression is induced by the addition of IPTG Transcription of T7 promoter is initiated by T7 Pol T7 DNA Polymerase necessary for expression of insert gene in plasmid How do we make T7 Pol to express our protein? Use strains with λ(DE3) which means that these E. coli cells have prophage (Engineered phage) that has T7 RNA polymerase controlled by Lac regulatory construct. Ex) BL21 λDE3 Which you have already used in lab!

BL21 DE3 Host Cell

BL21 DE3 Host Cell

Polymerase Chain Reaction polymerase chain reaction (PCR) is a method of amplifying a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. 1. DNA is heated to 90°C to separate the two DNA strands 2. DNA is cooled to 30-65°C to allow primer annealing. 3. Reaction is heated to 72°C to allow DNA polymerase to effectively synthesize new DNA strands, creating two new dsDNA molecules. 4. The cycle is repeated, each time the amount of DNA doubles. Forward Primer Reverse Primer 1. Melting 2. Annealing 3. Elongation 4. Repeat cycle ~ 30 times

Primer Design -1 Three Hydrogen Bonds Design primers that will dictate the region of interest We need two primers in PCR: Forward Reverse Two Hydrogen Bonds

Primer Design: G – C Content Factors to consider: Primers are typically around 18 – 22 bp long Tm – Melting Temperature Tm between 55 – 65 °C typically works best Tm of both primers should be within 5 °C of each other, the closer the better! Annealing temperature (Ta) is generally 5 °C lower than Tm Primers that have less G – C bonds will have a lower Tm than a similar length primer with more G – C bonds. G – C content target is ~45 – 55% For sequences longer than 13 nucleotides:      Tm= 64.9 +41*(yG+zC-16.4)/(wA+xT+yG+zC) Additional Factors to consider: Primers price depends on size; 21 bp > 20 bp (but they’re cheap unless tags are included on the primer) Primers larger than 60 bp become very expensive since synthesis becomes difficult and costs for validation increase Three Hydrogen Bonds (Stronger bond) Two Hydrogen Bonds (Weaker bond)

Primer Design - 2 3’ 5’ 3’ 5’ DNA Sequence GCAATGCACTACGATTCGATCTCATGACATC DNA Sequence CGTTACGTGTATGCTAAGCTAGAGTACTGTAG 3’ 5’ Complementary DNA sequence DNA is read in the 5’ to 3’ direction (unless specified) DNA Polymerase travels in the 3’ to the 5 ‘ direction on the template strand New DNA strand is synthesized from 5’ to 3’

Primer Design - 3 5’ 3’ 5’ 3’ 3’ 5’ DNA Sequence GCAATGCACTACGATTCGATCTCATGACATC DNA Sequence Better annealing if 3’ end is a C or G (more H-bonds = more “sticky”!) Helps anchor down DNA Polymerase when it comes in At least one but avoid more than 3 “G – C clamps” at 3’ end 5’ 3’ GCAATGCACATACGATTCGAT CGTTACGTGTATGCTAAGCTAGAGTACTGTAG 3’ 5’ Complementary DNA sequence

Primer Design - 4 3’ 5’ 5’ 3’ 3’ 5’ DNA Sequence GCAATGCACTACGATTCGATCTCATGACATC DNA Sequence DNA Pol Forward Primer 5’ 3’ GCAATGCACATACGATTCGATC CGTTACGTGTATGCTAAGCTAGAGTACTGTAG 3’ 5’ Complementary DNA sequence

Primer Design - 5 3’ 5’ 5’ 3’ 5’ 3’ 3’ 5’ DNA Sequence GCAATGCACTACGATTCGATCTCATGACATC DNA Sequence GCTAAGCTAGAGTACTGTAG DNA Pol 3’ 5’ Reverse Primer DNA Pol Forward Primer 5’ 3’ GCAATGCACATACGATTCGATC CGTTACGTGTATGCTAAGCTAGAGTACTGTAG 3’ 5’ Complementary DNA sequence

Primer Design - 6 3’ 5’ 5’ 3’ 5’ 3’ 3’ 5’ DNA Sequence GCAATGCACTACGATTCGATCTCATGACATC DNA Sequence GCTAAGCTAGAGTACTGTAG DNA Pol 3’ 5’ Reverse Primer DNA Pol Forward Primer 5’ 3’ GCAATGCACATACGATTCGATC CGTTACGTGTATGCTAAGCTAGAGTACTGTAG 3’ 5’ Complementary DNA sequence Ordering Primers: ALWAYS ORDER 5’ to 3’ DIRECTION! Forward Primer: 5’ – GCAATGCACATACGATTCGATC – 3’ Reverse Primer: 5’ – GATGTCATGAGATCGAATCG – 3’

Primer Design: What to Avoid? Secondary Structures: Minimize intramolecular homology “Hairpin loops” Interfere with annealing temperature Primer Dimers: Primers should not contain sequences that allow one primer to anneal to another primer ΔG of -7 kcal/mol or higher Cross homology: - Primer homology to non-target sequences Example: ΔG of -3.1 kcal/mol Example: ΔG of -1.6 kcal/mol

Primer Design: Example 1 link https://www.idtdna.com/calc/analyzer

Primer Design: Example 2 Tm is well above hairpin loop formation link https://www.idtdna.com/calc/analyzer

Adding Sequences to a Primer Gene of interest Q: What if our gene of interest doesn’t have the restriction sites that we desire? A: Design PCR primers with restriction sites that we want.

Adding Sequences to a Primer 1 Gene of interest Q: What if our gene of interest doesn’t have the restriction sites that we desire? A: Design PCR primers with restriction sites that we want.

Adding Sequences to a Primer 2 5’ 3’ GCAATGCACTACGATTCGATCTCATGACATC GCTAAGCTAGAGTACTGTAG 3’ 5’ Reverse Primer Add BamHI site here Add NdeI site here Forward Primer 5’ 3’ GCAATGCACATACGATTCGATC CGTTACGTGTATGCTAAGCTAGAGTACTGTAG 3’ 5’

Restriction Sequences Source: New England Biolabs

Adding Restriction Sites to a Primer BamHI 5’ 3’ GCAATGCACTACGATTCGATCTCATGACATC GCTAAGCTAGAGTACTGTAG 3’ 5’ Reverse Primer NdeI Forward Primer 5’ 3’ GCAATGCACATACGATTCGATC CGTTACGTGTATGCTAAGCTAGAGTACTGTAG 3’ 5’

Adding Restriction Sites to a Primer 3 BamHI 5’ 3’ GCAATGCACTACGATTCGATCTCATGACATC GCTAAGCTAGAGTACTGTAG 3’ 5’ Reverse Primer NdeI Forward Primer 5’ 3’ GCAATGCACATACGATTCGATC CGTTACGTGTATGCTAAGCTAGAGTACTGTAG 3’ 5’ Many restriction enzymes need additional nucleotides at the terminal ends of a DNA fragment to “sit” properly before cutting at their recognition site The number of nucleotides necessary depends on the enzyme

Cleavage Close to DNA Fragment May add on arbitrary sequence to the ends of your primers Stay within optimal G-C content!