Figure 17.4 DNA molecule Gene 1 Gene 2 Gene 3 DNA strand (template) TRANSCRIPTION mRNA Protein TRANSLATION Amino acid ACC AAACCGAG T UGG U UU G GC UC A Trp Phe Gly Ser Codon

A codon in messenger RNA Is either translated into an amino acid or serves as a translational start or stop signal Figure 17.5 Second mRNA base UCA G U C A G UUU UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG Met or start Phe Leu lle Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UGU UGC TyrCys CAU CAC CAA CAG CGU CGC CGA CGG AAU AAC AAA AAG AGU AGC AGA AGG GAU GAC GAA GAG GGU GGC GGA GGG UGG UAA UAG Stop UGA Stop Trp His Gln Asn Lys Asp Arg Ser Arg Gly U C A G U C A G U C A G U C A G First mRNA base (5 end) Third mRNA base (3 end) Glu

The following is the sequence of a bases on the template strand of DNA in the transcription unit 3’ – GGATCAGGTCCAGGCAATTTAGCATGCCCC – 5’ a) Transcribe this sequence into mRNA b) List the order of amino acids

Four Major Steps 1. Initiation 2. Elongation 3. Termination 4. Posttranscriptional Modification

Parts of a Gene promoter - DNA sequences which indicate the location of a gene promoters are located upstream from the DNA region that contains the information to be transcribed into mRNA promotertranscription region termination sequence gene

Orientation About a Gene RNA polymerase – transcription enzyme (synthesizes mRNA in 5’  3’ direction) uses upstream, promoter region to determine where to start mRNA transcription 0 positive numbersnegative numbers upstream downstream start transcription

Initiation dsDNA (double stranded DNA) needs to be opened for mRNA to be made promoter regions are often sequences of A’s and T’s 2 H-bonds between A&T easier to break than 3 H-bonds between G&C prokaryotic genes have a TATA box RNA polymerase opens the dsDNA

Initiation transcription factors - numerous protein factors are involved in starting transcription some of these proteins help control how often genes are transcribed Figure 17.8 TRANSCRIPTION RNA PROCESSING TRANSLATION DNA Pre-mRNA mRNA Ribosome Polypeptide TATAA A A ATATTTT TATA box Start point Template DNA strand Transcription factors Promoter RNA polymerase II Transcription factors RNA transcript Transcription initiation complex Eukaryotic promoters 1 Several transcription factors 2 Additional transcription factors 3

Elongation RNA polymerase synthesizes mRNA in the 5’  3’ direction no primer is necessary template strand - only one strand of the DNA is transcribed Elongation RNA polymerase Non-template strand of DNA RNA nucleotides 3 end C A U C C A A U T A G G T T A A C G G A T C A T CCA A T T G G Newly made RNA Direction of transcription (“downstream”) Template strand of DNA

Elongation Nomenclature the template strand is copied into mRNA strand also known as the antisense strand 5’ A T T A C G A T C T G C A C A A G A T C C T 3’ 5’ A U U A C G A U C U G C A C A A G A U C C U 3’ 3’ T A A T G C T A G A C G T G T T C T A G G A 5’ SENSE STRAND ANTISENSE STRAND DNA mRNA

Termination RNA polymerase stops transcribing once it reaches the termination sequence enzyme dissociates with DNA strand and binds to another promoter sequence termination sequences differ between prokaryotes and eukaryotes

Transcription

Transcription Animation Start watching at 1:30.

Transcription Figure 17.7 Promoter Transcription unit RNA polymerase Start point Rewound RNA transcript 3 3 Completed RNA transcript Unwound DNA RNA transcript Template strand of DNA DNA 1 Initiation. After RNA polymerase binds to the promoter, the DNA strands unwind, and the polymerase initiates RNA synthesis at the start point on the template strand. 2 Elongation. The polymerase moves downstream, unwinding the DNA and elongating the RNA transcript 5  3. In the wake of transcription, the DNA strands re-form a double helix. 3 Termination. Eventually, the RNA transcript is released, and the polymerase detaches from the DNA.

Posttranscriptional Modification mRNA of eukaryotic cells need to be modified before moving into the cytoplasm primary transcript – initial eukaryotic mRNA transcript, before modification 1. 5’ cap – 7-methylguanosine triphosphate 2. poly-A tail – approx. 200 adenine ribonucleotides are added at the end modifications prevent cellular enzymes from breaking down mRNA before it is translated into protein

Transcript Modification 5’ 3’ 5’ cap added by capping enzyme complex primary transcript 3’ poly-A tail added by poly-A polymerase AAAAAAA mG

5’ cap

Modifications: Introns / Exons eukaryotic genes are longer than prokaryotic genes we carry extra “junk” DNA most of this “junk” DNA signals when and how often genes should be transcribed  regulatory DNA primary transcript is longer than necessary exons – RNA sequences that will be expressed; helps makes the protein introns – interfering RNA sequences; need to be removed before translation

Transcript Modification AAAAAAA mG exon intron introns removed by spliceosome proteins AAAAAAA mG exon mRNA transcript

Spliceosome Complex Spliceosomes are a series of small nuclear ribonucleoproteins (snRNP) that work together to remove introns. snRNPs recognize specific sequences on the introns cuts out intron sequences splices exon sequences together RNA transcript (pre-mRNA) Exon 1 Intron Exon 2 Other proteins Protein snRNA snRNPs Spliceosome components Cut-out intron mRNA Exon 1 Exon

Classwork/Homework Section 5.3 – pg. 249 #1-5, 7-9