MUTATIONS Intro video https://www.youtube.com/watch?v=GieZ3pk9YVo.

Slides:



Advertisements
Similar presentations
Introduction to Human Genetics. Facts Humans have 46 chromosomes or 23 pairs of chromosomes 2 types of chromosomes: –Autosomes: chromosomes that determine.
Advertisements

Do Now Check, in your notes Replicate this DNA strand: CATCGG Transcribe this DNA strand in to RNA: CATAGG Write 3 differences between DNA and RNA.
Mutations.
Human Genetic Mutations
1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.
Let’s think about it… What are autosomes? What are sex chromosomes?
Gene Mutations. What are mutations and where do they occur?
 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,
MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.
To demonstrate understanding, after this lesson, you should be able to  define mutations  explain how mutations occur when – DNA Replication or Meiosis.
MUTATIONS.
Genetic Changes 11.3.
DNA and Genes Chapter DNA: The Molecule of Heredity Objectives Analyze the structure of DNA Determine how the structure of DNA enables it to.
Mutations Genetic Changes.
Ch Mutations Section Objectives:
Review: DNA, Transcription & Translation
Gene Mutations Chapter 11.
Genetic Mutations. Mutations Mistakes made in the DNA sequencing They can have a range of effects. They can affect the genetic information that is passed.
Mutations Any change in DNA sequence which is not immediately and properly repaired. If they occur in somatic cells then they are non-inheritable, if in.
MUTATIONS I. VOCABULARY A. Mutation- Any change in the __________ sequence. 1. Mutations in body cells may cause _______ to be made wrong or not.
  Understand what mutations are  Understand how they occur  Analyze the different types of mutations  Understand how mutations affect amino acid.
Genetic Disorders Genetic Mutations Because DNA controls characteristics of a cell it must be copied before a cell reproduces Sometimes mistakes occur.
Welcome to Genetic Mutations! 7x2WSY 7x2WSY.
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.
MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.
12.4 Mutations Copyright Pearson Prentice Hall.. What Are Mutations? Changes in the nucleotide sequence of DNA (genetic material) May occur in somatic.
GENETIC MUTATIONS What is this picture depicting?.
Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.
MUTATIONS  Several things can go wrong when DNA replicates.  Mutations.
Mutations and Genetic Disorders. Review One Wrong Letter Questions to think about: 1) How is the little boy in the video.
MUTATIONS *Mutations are mistakes made in DNA. *Mutations can be caused by either naturally occurring, random events, or by factors in the environment.
Genetics: Inheritance. Meiosis: Summary  Diploid Cells (2n): Cells with two sets of chromosomes, (aka “homologous chromosomes”)  One set of chromosomes.
DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.
DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcriptiontranslation.
Mutation Notes: Chapter 11.
Mutations.
Mutations.
11.3 Mutations.
Mutations.
Mermaid Syndrome Video.
Gene Mutations Chapter 11.
Copyright Pearson Prentice Hall
Genetic Mutations.
Genetic Mutations.
Gene Mutations.
Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?
Mutations.
Mutations LN #23 Ms. Garcia California Content Standard Genetics
Catalyst Create a circle map about mutations. Mutations.
Human Genetic Mutations
To be successful today…
DNA and Mutations.
Mutations Section 12-4.
Mutations.
Mutations Section 6.2.
Mutations.
4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.
Welcome to Genetic Mutations!
Cell Divisions & Mutations
Mutations A mutation is any change in the DNA sequence.
DNA and Mutations.
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Mutations A mutation is any change in the DNA sequence.
Draw a conclusion from this graph for both the red and blue line
10th Grade Biology Mr. Walker
1) Base Mutations 2) Chromosomal Mutations
Genetic Mutations.
Lesson 35 Mutations.
Presentation transcript:

MUTATIONS

Intro video

Mutations Mutations are changes in the DNA changes can be bad, good, or have no affect at all these changes can affect DNA, mRNA, proteins and traits

A change in reproductive cells can only be passed on to the next generation A change in body cells can not be passed on to the next generation but can cause cancer or cell death

Causes of Mutations 1.mistake during replication 2.Environmental: UV, chemicals, pollutants, radiation, high temperatures etc. and mutagens(agent which can cause change in DNA)

Types of Gene Level Mutations 1. Point Mutation-change in a single base pair i.e. The dog bit the cat. Mutation The dog bit the car. this mutation changes the meaning of the “sentence” which can result in the wrong protein created Ex. Sickle Cell

Point Mutations One base change can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCARANDTHEREDRATRAN THEFATCATENDTHEREDRATRAN OR Does this change the sentence? A LITTLE!

Frame Shift Mutation Frameshift Mutation-a single base pair is added or deleted. i.e. The dog bit the cat. Mutation The dob itt hec at. It causes a change in the reading frame Have more significant affects than point mutations Ex of diseases Tay Sachs, Cystic Fibrosis

Frameshift Mutations Add or delete one or more bases changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCANTANDTHEREDRATRAN THEFATCAANDTHEREDRATRAN OR Add one!Delete one! Does this change the sentence? A LOT!

Genetic Conditions Genetic disorders caused by mutations can be: autosomal or somatic/body cells. They can be dominant or recessive which can occur during mitosis on one of the 22 pairs of chromosomes Or Sex linked or gametes. They can be dominant or recessive which can occur during meiosis on chromosome 23

VIDEO (cystic fibrosis) (tay sachs) Unique mutations

DNA does a remarkable job repairing itself Mutation name game… 3_e.cfm