DNA genetic material- all your genes instructions for all the information necessary for an organism to grow and live found in the nucleus in eukaryotes
DNA is a nucleic acid macromolecule Shape: twisted ladder called a DOUBLE HELIX STRUCTURE
(STRUCTURE CONTINUED) DNA is made up of smaller units called nucleotides
Each nucleotide contains: 5-carbon sugar (backbone) Phosphate (backbone) Nitrogenous base (step)
BASES: DNA has 4 different chemical bases: A = Adenine T = Thymine C = Cytosine G = Guanine
Nucleotides are stacked on top of one another
DNA is two strands of nucleotides bound together by weak hydrogen bonds
1.Weak Hydrogen Bonds 2.Strong Carbon Bonds 3.Other Nucleotides 4.Adhesive Tape DNA IS BOUND TOGETHER BY WHAT?
DNA bases always pair up in the same way: A always pairs up with T C always pairs up with G
You may need this information… at college A T C olle G e REMEMBER IT THIS WAY…
If one strand of DNA has the following base sequence, which bases would the complementary strand contain? A T T C G C G T A C T G T A C THINK PAIR SHARE T A A G C G C A T G A C A T G
DNA FUNCTION: DNA strand is made up of letters: ATCGCTAGGACTAGTACTCAGTGA The letters make words: ATC GCT AGG ACT AGT ACT CAG TGA The words make sentences. These sentences are genes: > >
Genes tell the cells to make other molecules called PROTEINS Proteins help the cells to perform specific functions like hearing, muscle contraction, oxygen absorption, enzyme action Proteins make us who we are! (DNA FUNCTION CONTINUED)
BUILD A DNA MOLECULE