Tom Adie, Erika Cule & Rajdeep Ghataorhe 15/II/2008 Slide 1 of 6 _____________________________________________ Synthetic Biology Review A Synthetic Oscillatory.

Slides:

Advertisements

Similar presentations

Oscillation patterns in biological networks Simone Pigolotti (NBI, Copenhagen) 30/5/2008 In collaboration with: M.H. Jensen, S. Krishna, K. Sneppen (NBI)

Advertisements

Repressilator: “I’ll be back.”

Pattern Formation in Synthetic Bacterial Colonies Fran Romero and Karima Righetti Research Fellow School of Computer Science University of Nottingham Nottingham.

Modelling and Identification of dynamical gene interactions Ronald Westra, Ralf Peeters Systems Theory Group Department of Mathematics Maastricht University.

A SYNTHETIC GENE- METABOLIC OSCILLATOR Reviewed by Fei Chen.

VICTORIA HSIAO 1 Bacterial Edge Detector UT AUSTIN / UCSF IGEM Charles Darwin, immortalized.

Harvard iGEM 2006 Cyanobacterial Oscillator Hetmann Hsieh Jeff Lau Dave Ramos Zhipeng Sun Harvard iGEM 2006 Creating a robust biological oscillating biobrick.

Goal Show the modeling process used by both Collins (toggle switch) and Elowitz (repressilator) to inform design of biological network necessary to encode.

Predator-Prey models Intrinsic dynamics & Stability.

Many decades, huge area – spatially and temporally extensive cycling.

Repressilator Presentation contents: The idea Experimental overview. The first attemp. The mathematical model. Determination of the appropiate parameters.

Synthetic Biology = design and engineering of biological systems that aren’t found in nature Why would we want to do this? - Want to understand natural.

Project 6: Strawberry Nick Broadbent, Kelsey Lees and Tami Reuter.

Flashing Bacteria Morgan Haskell Coby Turner. What We Wanted To Do  University of California in San Diego  Biological synchronized clocks  Flash to.

1 Predator-Prey Oscillations in Space (again) Sandi Merchant D-dudes meeting November 21, 2005.

Cyanobacterial Oscillator in E. coli Why care about biological oscillators in the first place? Bio-oscillators have a number of potential applications:

BE/APh161 – Physical Biology of the Cell Rob Phillips Applied Physics and Bioengineering California Institute of Technology.

Two Species System n y ’ = rn y - an y n d –r = independent prey population increase rate –a = effect of predator on prey population n d ’ = bn y n d -

Deterministic and Stochastic Analysis of Simple Genetic Networks Adiel Loinger MS.c Thesis of under the supervision of Ofer Biham.

Deterministic and Stochastic Analysis of Simple Genetic Networks Adiel Loinger Ofer Biham Azi Lipshtat Nathalie Q. Balaban.

Adiel Loinger Ofer Biham Nathalie Q. Balaban Azi Lipshtat

Oscillatory Systems Jesse Wu Outline What is an oscillator? Types of oscillators Oscillator related things to think about.

A synthetic gene- metabolic oscillator Fung et al

Skip Counting Counting by 2, 5, and 10.

Ecology: Lectures Predation November 2, 2005.

Synthetic Gene Circuits Small, Middle-Sized and Huge Molecules Playing Together Within a Cell.

Morgan Haskell Coby Turner Dan Karkos. Jeff Hasty and team  University of California in San Diego Biological synchronized clocks ○ Flash to keep time.

MIT Molecular Machines (Jacobson) Group - Next Generation DNA Synthesis HTGAA.

Ch 9.5: Predator-Prey Systems In Section 9.4 we discussed a model of two species that interact by competing for a common food supply or other natural resource.

Using Logical Circuits to Analyze and Model Genetic Networks Leon Glass Isadore Rosenfeld Chair in Cardiology, McGill University.

Imperial Starting off: Week 1 Week 1 Engineering/Biology Introduction Lectures Journal Club WikiBrainstorming 3 ideas.

Information in Biology. Outline What is synthetic biology? Biological Clocks The “Repressilator” Signal transduction The “Diverter”

SELF-DIFFERENTIATED BACTERIAL ASSEMBLY LINE PEKING 2007 IGEM All ideas and images from Peking 2007 IGEM team unless otherwise noted Allen Lin 1.

Taattcgcggccgcttctagagattgtgagcggataacaattgacattgtgagcggataacaagatactgagcactactagagaaagaggagaaatactagatgactataatgataaaaaaat cggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactc.

Imperial College iGEM Jamboree MIT – Nov 4th 2006.

Construction of a genetic toggle switch in Escherichia coli Farah and Tom.

Synthetic Biology = design and engineering of biological systems that aren’t found in nature Why would we want to do this? - Want to understand natural.

Engineering a Molecular Predation Oscillator Thanks to staff from Imperial College for the support over.

Modelling concepts Modelling in discrete time (difference equations, also known as updating equations) Modelling in continuous time (differential equations)

Project: Repressilator

(genetic regulatory networks)

A Yeast Synthetic Network for In Vivo Assessment of Reverse-Engineering and Modeling Approaches Cantone, I., Marucci, L., Iorio, F., Ricci, M., Belcastro,

Quorum Sensing iGEM2007. Target (eg Nickel) luxI OHHL luxR.

Harvard iGEM 2005: Team BioWire and BioLoserz!!! LOL Orr Ashenberg, Patrick Bradley, Connie Cheng, Kang-Xing Jin, Danny Popper, Sasha Rush.

Bistable and Oscillatory Systems. Bistable Systems Systems which display two stable steady states with a third unstable state are usually termed bistable.

Imperial. Starting off: Week 1 Week 1 Engineering/Biology Introduction Lectures Journal Club WikiBrainstorming 3 ideas.

Ecology: Lectures 14 & 15 Predation, Parts 1 & 2.

Biology 2 Packet II Lab Predator-Prey Lab. Copy this information on the bottom of Pg. 88 in your Packet: The different color of yarn is the prey You are.

EBM: Control Freaks Model Zero: Two interacting species and a regulator who is informationally challenged.

Hetmann Hsieh Jeffrey Lau David Ramos Zhipeng Sun.

The little oscillator that could. and could…

Harvard iGEM 2006 Cyanobacterial Oscillator Hetmann Hsieh Jeff Lau Dave Ramos Zhipeng Sun Harvard iGEM 2006 Creating a robust oscillator BioBrick.

Harvard iGEM 2006 Cyanobacterial Oscillator Hetmann Hsieh Jeff Lau Dave Ramos Zhipeng Sun Harvard iGEM 2006 Creating a robust biological oscillating biobrick.

Synthetic Biology Sergio Peisajovich Lim Lab June 2007.

The synthetic microbial consortium oscillator

Skip Counting Counting by 2, 5, and 10.

Engineering Static and Dynamic Control of Synthetic Pathways

Nonlinear Control Systems ECSE-6420

Oscillating Fluorescence in E. coli

Skip Counting Counting by 2, 5, and 10.

Jeffrey C. Way, James J. Collins, Jay D. Keasling, Pamela A. Silver

Optimization of studies of gene networks models phase portraits

Cyanobacterial Oscillator

Virginia iGEM Workshop #2 High School Education Series.

Fuqing Wu, David J. Menn, Xiao Wang Chemistry & Biology

Cyanobacterial Oscillator

Cyanobacterial Oscillator

Cyanobacterial Oscillator

Cyanobacterial Oscillator

Cyanobacterial Oscillator

Presentation transcript:

Tom Adie, Erika Cule & Rajdeep Ghataorhe 15/II/2008 Slide 1 of 6 _____________________________________________ Synthetic Biology Review A Synthetic Oscillatory Network of Transcriptional Regulators – ‘The Repressilator’ Elowitz, M.B. & Leibler, S. Nature, vol. 403, 20 th January 2000

Tom Adie, Erika Cule & Rajdeep Ghataorhe 15/II/2008 Slide 2 of 6 _____________________________________________ The Basics

Tom Adie, Erika Cule & Rajdeep Ghataorhe 15/II/2008 Slide 3 of 6 _____________________________________________ The Good Results...

Tom Adie, Erika Cule & Rajdeep Ghataorhe 15/II/2008 Slide 4 of 6 _____________________________________________...and the Other Results ◄ Limitations (c): » Accumulation of GFP as a result of limited elimination » Green – oscillation with a reduced period » Blue – several periods skipped entirely ◄ Controls (f): » Cells containing only the reporter plasmid Stochastic effects…

Tom Adie, Erika Cule & Rajdeep Ghataorhe 15/II/2008 Slide 5 of 6 _____________________________________________ ◄ iGEM Solution: » Novel approach based on Lotka-Volterra model of predator-prey interaction » Constitutively repressed ‘predator’ cell is anti-repressed by product of ‘prey’ cell » Prey cell is repressed by product of predator cell… » Thus a stable oscillation cycle is built up Conclusions & Extensions Cell A Lux R Lux I Plux A A Cell B LuxR AA aiiA Plux AiiA LuxR

Tom Adie, Erika Cule & Rajdeep Ghataorhe 15/II/2008 Slide 6 of 6 _____________________________________________ The Network Model Deterministic Continuous / Stochastic Discrete Continuous model: