A Supplementary Figure 1. ChIP-seq Sequencing Statistics b RNA-seq Sequencing Statistics Sample NameSequencing Depth Uniquely Mapped Reads Number of peaks.

Slides:

Advertisements

Similar presentations

Control siRNA BRG1 siRNA PTEN – Akt – p-Akt – p-GSK-3  – Cyclin D1 – BRG1 –  -actin – SW480 Supplemental data S1 Supplemental data S1. Effects of transduction.

Advertisements

27 lncRNAs (predictive of subtype) 10 lncRNAs (TS & Onc.) 8 lncRNAs 4 lncRNAs (BALR-1, BALR-2, BALR-6, LINC00958) 114 lncRNAs 2 lncRNAs (BALR-2, BALR-6)

RNA-seq Analysis in Galaxy

Supplementary Material Supplementary Tables Supplementary Table 1. Sequencing statistics for ChIP-seq samples. Supplementary Table 2. Pearson correlation.

LECTURE 2 Splicing graphs / Annoteted transcript expression estimation.

Model Selection in Machine Learning + Predicting Gene Expression from ChIP-Seq signals

Controls for TTS identification using PET A series of controls were implemented in order to evaluate the potential contamination by internal priming in.

Genomics and High Throughput Sequencing Technologies: Applications Jim Noonan Department of Genetics.

Ct log DNA （ pmol) P1P2 Supplementary Fig. S1 Standard curve of the PCR amplification efficiency of transcripts.

Supplementary Figure 1. Compararison of the expression of the genes within the 10q23 locus using either Troglitazone or Rosiglitazone as the PPAR  agonist.

Differential Principal Component Analysis (dPCA) for ChIP-seq

4 male, 4 female LCLs HumanChimpanzeeRhesus Macaque Expression: RNAseq Active Gene Marks: Pol II (ChIPseq) H3K4me3 (ChIPseq) Repressed Region Mark: H3K27me3.

A B IL-4(+) IL-4(-) IL-4(+) IL-4(-) ChIP-Seq (STAT6) Ramos IL-4 (+) P-value Ramos IL-4 (-) P-value BEAS2B IL-4 (+) P-value BEASB IL-4 (-) P-value fold.

Sh-luc shSCP1-1 * IB: c-Myc IB: Tubulin shSCP1-2 IB: p-Ser KD 70KD 60KD 70KD (abnova) sh-luc shSCP1-1 * IB: c-Myc IB: Tubulin shSCP1-2.

Figure S1 Enod11 Mtc27 MtGshs cDNA gDNA S. meliloti DPI Supporting Information Fig. S1. Validation of the selected biological conditions for.

Supplementary Figure S1 FPKM ESRP1ESRP2 normaltumor Supplementary Figure S1. ESRP1 and ESRP2 mRNA expression in 65 normal kidney samples and 474 ccRCC.

*** * * * Figure S1 Supplementary Figure 1. Analysis of JARID1A–D mRNA levels showed that JARID1D knockdown had insignificant or weak effects on expression.

BA c-myc gene E CP U2 snRNA gene PSE DSE U TERM Figure S1 Chromatin IP H3 (% input)

Supplementary Figure S1. Knockdown of Twist1 mRNA increases Foxa1 expression in MDA-MB-436 cells. Total RNA and protein samples were prepared from MDA-MB-436.

Supplementary Figure 1. (A) Expression of DSB repair proteins

RNA Quantitation from RNAseq Data

Supplementary figure 5.

Figure 1. Effect of acute TNF treatment on transcription in human SGBS adipocytes as assessed by RNA-seq and RNAPII ChIP-seq. Following 10 days in vitro.

Table 1: Efficiency for target genes

Volume 41, Issue 5, Pages (November 2014)

Crucial Roles of MZF1 and Sp1 in the Transcriptional Regulation of the Peptidylarginine Deiminase Type I Gene (PADI1) in Human Keratinocytes Sijun Dong,

Membrane-Tethered Intracellular Domain of Amphiregulin Promotes Keratinocyte Proliferation Stefan W. Stoll, Philip E. Stuart, Sylviane Lambert, Alberto.

Volume 55, Issue 1, Pages (July 2014)

Volume 21, Issue 1, Pages e6 (July 2017)

Sensitivity of RNA‐seq.

Volume 16, Issue 12, Pages (September 2016)

Comparative analysis of RNA and protein profiles.

Molecular Therapy - Nucleic Acids

Volume 44, Issue 3, Pages (November 2011)

A B C Vinculin Vinculin HBP1 HBP1 p63 Loricrin Supplementary 2.

Supplementary table S1 by Shin et al.

Volume 23, Issue 5, Pages (May 2018)

Adrien Le Thomas, Georgi K. Marinov, Alexei A. Aravin Cell Reports

8 slides for 4 panels (A-D)

Volume 16, Issue 12, Pages (September 2016)

Figure 7. Primary cells from prostate tumours are more sensitive to ML than adjacent non-cancerous cells from the ... Figure 7. Primary cells from.

The transcript profiles in the three human cell lines based on RNA sequencing (RNA‐seq). The transcript profiles in the three human cell lines based on.

Role of Sp1 in Transcription of Human ATP2A2 Gene in Keratinocytes

Supplementary Figure S1: Purity for naïve and memory subsets

The DHX15–CMTR1 interaction inhibits translation of a subset of genes.

Volume 44, Issue 3, Pages (November 2011)

Volume 5, Issue 5, Pages (November 2015)

Discovery, Annotation, and Functional Analysis of Long Noncoding RNAs Controlling Cell-Cycle Gene Expression and Proliferation in Breast Cancer Cells

Volume 51, Issue 5, Pages (September 2013)

Volume 21, Issue 9, Pages (November 2017)

Volume 25, Issue 4, Pages (April 2017)

Volume 63, Issue 3, Pages (August 2016)

Volume 129, Issue 7, Pages (June 2007)

Emma Abernathy, Sarah Gilbertson, Ravi Alla, Britt Glaunsinger

Volume 5, Issue 6, Pages (December 2015)

Rational Design of Therapeutic siRNAs: Minimizing Off-targeting Potential to Improve the Safety of RNAi Therapy for Huntington's Disease Ryan L Boudreau,

Fig. 3. Coilin levels correlate with altered nascent U2 snRNA, hTR and rRNA levels.RNA isolated from HeLa or WI-38 cells following RNAi targeting coilin.

Knockdown of endogenous WT-hTER by a short hairpin RNA (siRNA) directed specifically against the human WT telomerase RNA template. Knockdown of endogenous.

Fig. 4 p100/TSN enables E2F1 to interact with alternatively spliced transcripts. p100/TSN enables E2F1 to interact with alternatively spliced transcripts.

Formation of the Androgen Receptor Transcription Complex

Volume 26, Issue 12, Pages e5 (March 2019)

Lats2 functions at the G1–S checkpoint in U2OS cells.

Volume 55, Issue 1, Pages (July 2014)

Volume 2, Issue 4, Pages (October 2012)

Identification of chromatin modifying complex recruiting H3K9 methyltransferases. a, A MEME-ChIP analysis was performed to identify the transcription factor.

PELP1 regulates the expression and activities of MMPs in ER-negative cells. PELP1 regulates the expression and activities of MMPs in ER-negative cells.

G34 H3K36me3 upregulates MYCN which is selectively targetable by kinases that destabilize the protein. G34 H3K36me3 upregulates MYCN which is selectively.

DDX5 localizes to promoters of DNA replication genes and functions in the loading of RNA polymerase II onto these promoters. DDX5 localizes to promoters.

Fig. 2 hTERT induces expression of heat shock protein genes through HSF1 and interacts with Hsp70-1. hTERT induces expression of heat shock protein genes.

Presentation transcript:

a Supplementary Figure 1

ChIP-seq Sequencing Statistics b RNA-seq Sequencing Statistics Sample NameSequencing Depth Uniquely Mapped Reads Number of peaks H3K4me329,607,43822,520, PolII186,897,451139,395, Input71,328,88454,200,494 c Supplementary Figure 1 Sample NameSequencing DepthUniquely Mapped Reads Basal siCTRL_ siCTRL_ siUPF1_ siUPF1_ siCTRL_ siCTRL_ siEXOSC5_ siEXOSC5_ siCTRL siSTAU1_ siSTAU1_

BRIC-seq Sequencing statistics d Sample NameSequencing DepthUniquely Mapped Reads siCTRL_1 0h siCTRL_1 4h siCTRL_1 8h siCTRL_1 12h siUPF1 0h siUPF1 4h siUPF1 8h siUPF1 12h siCTRL_1 0h siCTRL_1 4h siCTRL_1 8h siCTRL_1 12h siCTRL_1 24h siEXOSC5 0h siEXOSC5 4h siEXOSC5 8h siEXOSC5 12h siEXOSC5 24h Supplementary Figure 1

Sample NameSequencing DepthUniquely Mapped Reads siCTRL_0min_ siCTRL_0min_ siCTRL_15min_ siCTRL_15min_ siCTRL_45min_ siCTRL_45min_ siCTRL_75min_ siCTRL_75min_ siCTRL_105min_ siCTRL_105min_ siCTRL_165min_ siCTRL_165min_ siCTRL_225min_ siCTRL_225min_ siCTRL_345min_ siCTRL_345min_ siCTRL_465min_ siCTRL_465min_ siCTRL_585min_ siCTRL_585min_ siCTRL_705min_ siCTRL_705min_ siSTAU1_0min_ siSTAU1_0min_ siSTAU1_15min_ siSTAU1_15min_ siSTAU1_45min_ siSTAU1_45min_ siSTAU1_75min_ siSTAU1_75min_ siSTAU1_105min_ siSTAU1_105min_ siSTAU1_165min_ siSTAU1_165min_ siSTAU1_225min_ siSTAU1_225min_ siSTAU1_345min_ siSTAU1_345min_ siSTAU1_465min_ siSTAU1_465min_ siSTAU1_585min_ siSTAU1_585min_ siSTAU1_705min_ siSTAU1_705min_ BRIC-seq Sequencing statistics (continued) Supplementary Figure 1

Supplementary Figure 2 a)b) c)d) Half-lives: BRIC: >24h ActD: >24h Half-lives: BRIC: >24h ActD: >24h Half-lives: BRIC: 1.72h ActD: 1.72h Half-lives: BRIC: 2.09h ActD: 1.70h

Supplementary Figure 2 e)f) g)h) Half-lives: BRIC: >24h ActD: >24h Half-lives: BRIC: >24h ActD: >24h Half-lives: BRIC: 1.90h ActD: 4.62h Half-lives: BRIC: 1.61h ActD: 3.19h

b Predicted expression(log10) c a Observed expression (log10) Observed expression (log10) Predicted expression(log10) Observed expression (log10) Supplementary Figure 3

Supplementary Figure 4 b HIC1 ZNF783 Remaining transcripts (%) Time (hours) Remaining transcripts (%) Time (hours) a c

a Supplementary Figure 5 Cell typeExperimental factorsURLLaboratory GM12878 H3k4me3 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeBroadHistone/wgEncodeBroadHiston eGm12878H3k04me3StdPkV2.broadPeak.gz Broad Pol2 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeOpenChromChip/wgEncodeOpenChr omChipGm12878Pol2Pk.narrowPeak.gz UT-A H3k36me3 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeBroadHistone/wgEncodeBroadHiston eGm12878H3k36me3StdPk.broadPeak.gz Broad H1-hESC H3k4me3 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeBroadHistone/wgEncodeBroadHiston eH1hescH3k4me3StdPk.broadPeak.gz Broad Pol2 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeOpenChromChip/wgEncodeOpenChr omChipH1hescPol2Pk.narrowPeak.gz UT-A H3k36me3 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeBroadHistone/wgEncodeBroadHiston eH1hescH3k36me3StdPk.broadPeak.gz Broad K562 H3k4me3 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeBroadHistone/wgEncodeBroadHiston eK562H3k4me3StdPk.broadPeak.gz Broad Pol2 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeBroadHistone/wgEncodeBroadHiston eK562Pol2bStdPk.broadPeak.gz Broad H3k36me3 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeBroadHistone/wgEncodeBroadHiston eK562H3k36me3StdPk.broadPeak.gz Broad HepG2 H3k4me3 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeBroadHistone/wgEncodeBroadHiston eHepg2H3k04me1StdPk.broadPeak.gz Broad Pol2 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeOpenChromChip/wgEncodeOpenChr omChipHepg2Pol2Pk.narrowPeak.gz UT-A H3k36me3 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeBroadHistone/wgEncodeBroadHiston eHepg2H3k36me3StdPk.broadPeak.gz Broad HUVEC H3k4me3 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeBroadHistone/wgEncodeBroadHiston eHuvecH3k4me3StdPk.broadPeak.gz Broad Pol2 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeBroadHistone/wgEncodeBroadHiston eHuvecPol2bStdPk.broadPeak.gz Broad H3k36me3 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeBroadHistone/wgEncodeBroadHiston eHuvecH3k36me3StdPk.broadPeak.gz Broad MCF-7 H3k4me3 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeUwHistone/wgEncodeUwHistoneMcf 7H3k4me3StdPkRep1.narrowPeak.gz USC Pol2 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeOpenChromChip/wgEncodeOpenChr omChipMcf7Pol2PkRep1.narrowPeak.gz UT-A H3k36me3 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeSydhHistone/wgEncodeSydhHistone Mcf7H3k36me3bUcdPk.narrowPeak.gz USC NHEK H3k4me3 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeBroadHistone/wgEncodeBroadHiston eNhekH3k4me3StdPk.broadPeak.gz Broad Pol2 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeBroadHistone/wgEncodeBroadHiston eNhekPol2bStdPk.broadPeak.gz Broad H3k36me3 ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeBroadHistone/wgEncodeBroadHiston eNhekH3k36me3StdPk.broadPeak.gz Broad DLD-1 H3k4me3 DBTSS Pol2 DBTSS H3k36me3 DBTSS

b Supplementary Figure 5 Cell typeExperimental factorsURLLaboratory GM12878 Cell ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqGm12878CellPapGeneGencV7.gtf.gz CSHL Nucleus ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqGm12878NucleusPapGeneGencV7.gtf.gz CSHL Cytosol ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqGm12878CytosolPapGeneGencV7.gtf.gz CSHL H1-hESC Cell ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqH1hescCellPapGeneGencV7.gtf.gz CSHL Nucleus ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqH1hescNucleusPapGeneGencV7.gtf.gz CSHL Cytosol ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqH1hescCytosolPapGeneGencV7.gtf.gz CSHL K562 Cell ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqK562CellPapGeneGencV7.gtf.gz CSHL Nucleus ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqK562NucleolusTotalGeneGencV7.gtf.gz CSHL Cytosol ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqK562CytosolPapGeneGencV7.gtf.gz CSHL HepG2 Cell ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqHepg2CellPapGeneGencV7.gtf.gz CSHL Nucleus ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqHepg2NucleusPapGeneGencV7.gtf.gz CSHL Cytosol ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqHepg2CytosolPapGeneGencV7.gtf.gz CSHL HUVEC Cell ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqHuvecCellPapGeneGencV7.gtf.gz CSHL Nucleus ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqHuvecNucleusPapGeneGencV7.gtf.gz CSHL Cytosol ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqHuvecCytosolPapGeneGencV7.gtf.gz CSHL MCF-7 Cell ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqMcf7CellPapGeneGencV7.gtf.gz CSHL Nucleus ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqMcf7NucleusPapGeneGencV10.gtf.gz CSHL Cytosol ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqMcf7CytosolPapGeneGencV10.gtf.gz CSHL NHEK Cell ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqNhekCellPapGeneGencV7.gtf.gz CSHL Nucleus ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqNhekNucleusPapGeneGencV7.gtf.gz CSHL Cytosol ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeCshlLongRnaSeq/wgEncodeCshlLong RnaSeqNhekCytosolPapGeneGencV7.gtf.gz CSHL DLD-1 DBTSS

R = 0.38 R = 0.32 R = 0.64R = 0.40 R = 0.57R = 0.34 R = 0.70 R = 0.60 R = 0.28 R = 0.36 R = 0.28 R = 0.32 R = 0.29 R = 0.31R = 0.40 R = 0.27 Supplementary Figure 6 RNA Expression H3K4me3 Intensities RNA Expression

Supplementary Figure 7 Refseq (mRNA) lincRNA Frequency in different cell types Frequency of Occurrences

Supplementary Figure 8 RT-qPCR and Western blot used to determine knockdown efficiencies b c a e f d siCTRL siEXOSC5_1 siEXOSC5_2 siCTRL siUPF1_1 UPF1 EXOSC5 α-tubulin siCTRL siSTAU1_1 STAU1 α-tubulin siSTAU1_2

siRNAs uesd for knock-down and oligonucleotides used for qPCR Name Sence sequece (5'-3') Antisense sequece (5'-3') siRNAs Control siRNA-1GTACCTGACTAGTCGCAGAAGTCTGCGACTAGTCAGGTACGG Control siRNA-2UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT UPF1 siRNA-1GAUGCAGUUCCGCUCCAUUdTdTAAUGGAGCGGAACUGCAUCdTdT UPF1 siRNA-2AAUUUCUGUAACUUGUUUCCUGAAACAAGUUACAGAAAUUAC EXOSC5 siRNA-1CAACACGUCUUCCGUUUCUdTdTAGAAACGGAAGACGuGuuGdTdT EXOSC5 siRNA-2GCAAAGAGAUUUUCAACAAdTdTUUGUUGAAAAUCUCUUUGCdTdT siSTAU1-1CUCUGCGUGUGGUCCGUAUGGAUACGGACCACACGCAGAGCC siSTAU1-2CAGGGGAUCAAUCCGAUUAGCUAAUCGGAUUGAUCCCCUGGC Primer pairs for RT-qPCR GAPDHGCACCGTCAAGGCTGAGAACTGGTGAAGACGCCAGTGGA UPF1AGATCACGGCACAGCAGATTGGCAGAAGGGTTTTCCTT EXOSC5CCACACTCGAAGTGATCCTGCCGGCTCTTCTCTGCAAC STAU1TATCGGCAAGGATGTGGAGTTGGTCCAACTCAGACAGCAA HIC1GATGCTGGACACGATGGACTTGGTGCGCTGGTTGTT PVT1 CTCTTCCTGGTGAAGCATCTGATGGCTGTATGTGCCAAGGT XLOC_ TTTCAGAGGTTCTTTAGGGAAAAGACGTGCAAGAGGTCAAAGAAC XLOC_ GGACTGAGGCAACCCATCTATTCAAGATGAACCTTATGAGTGGT XLOC_ GGGGGCTCTGTGATATGCTATTCCTTTTCCTCTTGGGTTTAGT XLOC_ TGGAATATGGCTAATGTAAAGTTCAGCCCGTTCTTGTGGTAGAAG BAMBI CGCCACTCCAGCTACATCTTCACAGTAGCATCGAATTTCACC ZNF574 CGACGGCGAGAGCTAGAGCCTCTGATTCCTCAGTCATGG ZNF691 CCTTCCCTCGCCTACAGAGTCAGGCAGGTGTGGTTCTG ZBED5 TGAAGAGTGCATTTCAAGCTGTGGTACACCTTTTCTTAAAGGTAGATT MMP2 CCCCAAAACGGACAAAGAGCTTCAGCACAAACAGGTTGC SLC25A23 GAATTTTCCCGCTATCTGCCTGTTGGATCTCAGAGACATCAAT Supplementary Figure 9

Assumed differential equation: RNA half-life: Supplementary Figure 10

Supplementary Figure 11 Experimental factorsCell typeGM12878H1-hESCK562HepG2HUVECMCF-7NHEKDLD-1 H3K4me3 No. of peaks73,95233,27052,422138,70940,94869,52551,31016,917 No. of peaks (>= fold10)6,03522,30326,06311,33323,28267,45828,42811,498 Pol2 No. of peaks33,71035,87754,27741,66638,86250,97343,49632,865 No. of peaks (>= fold10)0025,315047,713028,3549,167 H3K36me3 No. of peaks141,174173,09162,502252,66090,694157,26756,505101,691 No. of peaks (>= fold10)14,12310,72726,46821,61516,0956,29121,42927,693 Experimental factorsCell typeGM12878H1-hESCK562HepG2HUVECMCF-7NHEKDLD-1 H3K4me3No. of genes14,81714,83413,71816,06214,25814,18614,87411,954 Pol2No. of genes14,64214,54513,69213,48013,69213,09313,15312,306 H3K36me3No. of genes11,50811,57111,52411,42011,7827,54212,21410,996 all positive No. of genes10,61110,19410,56910,90210,6407,28610,9719,706 No. of genes (>= fold10)2,2468,9067, ,4857,2779,3669,464 No. of genes (< 1RPKM)1,5821,3211,5221,4701, , No. of genes (>= 1RPKM)9,0298,8739,0479,4329,1907,0399,4839,585 No. of genes (>= fold10 & < 1RPKM)1481, , ,01486 No. of genes (>= fold10 & >= 1RPKM)2,0987,8387, ,3647,0328,3529,378 No. of genes (>= fold25 & < 1RPKM) No. of genes (>= fold25 & >= 1RPKM)81, ,6117,0022,2007,830 Experimental factorsCell typeGM12878H1-hESCK562HepG2HUVECMCF-7NHEKDLD-1 H3K4me3No. of genes5,0233,6684,0156,8023,7843,5594,5812,022 Pol2No. of genes4,8244,1414,5293,1754,5542,6254,1482,894 H3K36me3No. of genes2,2932,1432,5931,9152, ,4911,077 all positive No. of genes1, ,7421,2331,197951, No. of genes (>= fold10) , , No. of genes (< 1RPKM) , ,21455 No. of genes (>= 1RPKM) No. of genes (>= fold10 & < 1RPKM) No. of genes (>= fold10 & >= 1RPKM) No. of genes (>= fold25 & < 1RPKM) No. of genes (>= fold25 & >= 1RPKM)

Cell TypeP Value Gm H1hesc3.73E-14 K Hepg20.17 Huvec0.31 Mcf70.37 Nhek0.008 ChIP+/ RNA- OtherChIP+/ RNA- OtherChIP+/ RNA- Other ChIP+/ RNA- Other ChIP+/ RNA- Other ChIP+/ RNA- Other ChIP+/ RNA- Other Nuclear to Cytoplasm ratio (N/C) Supplementary Figure 12