1. A B IL-4(+) IL-4(-) IL-4(+) IL-4(-) ChIP-Seq (STAT6) Ramos IL-4 (+) P-value Ramos IL-4 (-) P-value BEAS2B IL-4 (+) P-value BEASB IL-4 (-) P-value fold (IP/WCE in 121 bp bin)= 10.24 0.460.57 20.07 0.200.3 30.02 0.070.13 40.003 0.020.046 54E-04 0.0050.014 65.7E-05 1.0E-033.6E-03 76.6E-06 2.0E-048.5E-04 86.8E-07 3.4E-051.8E-04 96.3E-08 5.1E-063.3E-05 105.4E-09 7.1E-075.7E-06 Ramos IL-4 (+) #total peak Ramos IL-4 (-) #total peak BEAS2B IL-4 (+) #total peak BEAS2B IL-4 (-) #total peak window size= 60 bp13191711324491 121 bp60073773314 180 bp25920504168 C D (fold) Enrichment against background Supplementary Figure S1

2. False Detection Rate (fold=10)#Total Peak (121bp) RamosBEAS2BRamosBEAS2B IL-4(+)IL-4(-)IL-4(+)IL-4(-)IL-4(+) H3K4me35.5E-071.7E-077.3E-083.1E-082736424281 H3Ac3.1E-081.9E-07 2.9E-084629437480 Pol II8.1E-058.9E-051.6E-051.4E-051743113457 H3K4me3 H3Ac Pol II (fold) H3K4me3 H3Ac Pol II (fold) EF G Enrichment against background Supplementary Figure S1. Validation of the detected binding sites by independent real time PCR in Ramos cells (A) and BEAS2B (B) cells. Fold enrichment (y-axis) was calculated based on delta Ct method against the non-binding intergenic genomic region for detected STAT6 binding site in each gene. Red and blue bars represent the results from IL-4 (-) and IL-4 (+) experiments, respectively. PCR primers used for each region are shown in (Supplementary Table S2). Estimated false detection rate (C) and number of detected binding sites of STAT6 (D), when different cutoffs were used. (E-G) Similar validation analysis for ChIP Seq analyses of H3K4me3, H3Ac and pol II. Genomic coordinate used for the analyses are shown in Supplementary Table S2. The parameters used in the text are indicated by a red box. WCE: whole cell extract genome used for the background control. Error bars are standard deviations of the triplicate experiments. Supplementary Figure S1

3. ---+----+-Competitor -++++-++++Nuclear protein --+++--+++IL4 stimulation ----+----+anti-STAT6 NM_003791NM_022913 12345678910 Super Shift Complex Supplementary Figure S2. STAT6 bind to the TCTCGCG sequence in BEAS2B cells. Nuclear protein was extracted from BEAS2B cells with or without IL-4. Left side was used NM_003791 (MBTPS1) probe and right side was used NM_0022913 (GPBP1) probe. Supplementary Figure S2

4. A TSSseq Fold 4.97.99.16.111.913.7 TSSseq Fold 2.86.128.413.215.026.0 B cell type Ramos IL-4 (+) Ramos IL-4 (-) BEAS2B IL-4 (+) BEAS2B IL-4 (-) total outside of the Refseq region2,453,4792,764,432501,068546,381 16,814,181 within the Refseq region12,815,01413,875,72714,317,74811,082,366 68,573,421 upstream3,373,4264,121,6513,655,5183,215,510 22,462,370 first exon7,129,6307,602,5317,831,9726,261,221 33,317,005 second or later exon 762,470738,3661,680,299962,612 6,463,399 intron1,549,4881,413,1791,149,959643,023 6,330,647 %full9495889181 cell type Ramos IL-4 (+) Ramos IL-4 (-) BEAS2B IL-4 (+) BEAS2B IL-4 (-) #TSC (total) 24764021390114105184198 #TSC (>1ppm) 33196321284135937335 C D Enrichment against background Supplementary Figure S3

5. si-Stat si-GAPDH cell type si Control IL-4 (+) si Control IL-4 (-) siSTAT6 IL-4 (+) siSTAT6 IL-4 (-) outside of the Refseq region3,501,0643,189,8382,317,6532,421,010 within the Refseq region4,742,0364,667,6713,562,1243,510,735 upstream 1,960,0002,122,6492,040,1941,973,422 first exon 1,070,9211,422,152937,3981,061,180 second or later exon 992,511690,723341,180295,238 intron 718,604432,147243,352180,895 %full79859091 cell type si Control IL-4 (+) si Control IL-4 (-) siSTAT6 IL-4 (+) siSTAT6 IL-4 (-) #TSC (total) 228766125664155016103794 #TSC (>1ppm) 42511457534150944407 E F G Enrichment against background Supplementary Figure S3

6. Supplementary Figure S3. Validation Analyses of TSS Seq. Real time RT-PCR validation of the transcripts which were identified as being induced by IL-4 stimulation in Ramos cells (A) and BEAS2B (B) cells. Fold induction of the transcript levels were calculated against GAPDH by delta Ct method. Fold difference evaluated by digital TSS Seq tag counts are shown in the margin for each gene. (C) Mapped positions of the TSS Seq tags relative to the RefSeq genes are shown. %full was calculated as (#“upstream”+#”first exon”+#“intron”)/(#“total tags”) within the RefSeq region. (D) Number of TSCs having the indicated expression levels. (E) Knockdown experiments of STAT6. Knockdown efficiency (y-axis) of each gene was evaluated by real time RT-PCR using delta Ct method against non-targeting siRNA. siRNA used for each experiment is shown in the inset. Sequences of the siRNAs are shown in Supplementary Table S2. (F, G) Evaluation of the TSS Seq libraries constructed using STAT6- knowckdown BEAS2B cells. Error bars are standard deviations of the triplicate experiments. Supplementary Figure S3

7. ChIP (STAT6) Ramos IgM# total reads80,673,092 # IL-4(+) Peaks7887 # IL-4(-) Peaks9969 110 cell type Ramos IgM(+) IL-4(+)IgM(+) IL-4(-) outside of the Refseq region639,267399,820 within the Refseq region10,719,2876,301,263 upstream3,013,5061,797,419 first exon6,770,0783,971,466 second or later exon266,685165,318 intron669,018367,060 %full92 A B D cell type Ramos IgM(+) IL-4 (+)IgM (+) IL-4 (-) #TSC (total) 84,66274,417 #TSC (>1ppm) 16,09017,722 C 121 115 2 ChIP positive ChIP & TSS positive IL4 IgM IL4 IgM IL4 Supplementary Figure S4

8. # TSS tag (ppm) Ramos IgM(+) IL-4(+) 59 (5.2) Ramos IgM(+) IL-4(-)17 (2.5) IL4(+) STAT6 (IP) IL4(+) STAT6 (WCE) ChIP Seq TSS Seq IgM(+) IL-4 (+) IgM(+) IL-4 (-) NM_016483 （ PHF7) E Supplementary Figure S4

9. Supplementary Figure S4. Identification of STAT6 target in antigen-stimulated Ramos cells. (A) Summary of the ChIP Seq analyses of STAT6. The numbers of peaks detected using the described parameters are shown. (B) Mapped positions of the TSS Seq tags relative to the RefSeq genes are shown. %full was calculated as (#“upstream”+#”first exon”+#“intron”)/(#“total tags”) within the RefSeq region. (C) Number of TSCs having the indicated expression levels. (D) Comparison Ramos IL4(+) and Ramos IgM(+) IL-4(+) peaks. Upper panel was ChIP positive peaks and lower panel was ChIP & TSS positive peaks. (E) Examples of identified STAT6 targets in authentic RefSeq promoter regions in Ramos cells. STAT6 binding sites are indicated by red lines. Expression changes evaluated by digital TSS tag counts are also shown in the bottom margin. Discussion: Interestingly, we compared the targets identified from antigen-stimulated and non-stimulated conditions and found that most of them did not overlap. Particularly, we observed that 20% of ChIP Seq positive sites overlapped, though with rare exceptions, they did not induce the downstream transcriptional initiations. These results also suggested that transcriptional regulations controlled by STAT6 are complex, depending on cellular conditions. Further details will be published elsewhere. Supplementary Figure S4

10. NM_016077(PTRH2) # TSS tag (ppm) BEAS2B IL-4(+) 1574 (103.7) BEAS2B IL-4(-)331 (28.4) NM_207123(GAB1) # TSS tag (ppm) Ramos IL-4(+) 388 (25.4) Ramos IL-4(-)36 (2.2) STAT6 (IP) H3Ac (IP) H3K4me3 (IP) Pol II (IP) STAT6 (WCE) H3Ac (WCE) H3K4me3 (WCE) Pol II (WCE) ChIP Seq TSS Seq IL-4 (+) IL-4 (-) Supplementary Figure S5 A

11. Supplementary Figure S5. Examples of identified STAT6 targets. (A) Other examples of the identified STAT6 targets in authentic promoter regions (left panel) and putative alternative regions (right panel) in Ramos cells. Also see the main text. Supplementary Figure S3

12. Active target Silent target Ramos IL-4 (-) IL-4 (+) BEAS2B IL-4 (-) IL-4 (+) STAT6 pol II active chromatin additional factor 1 transcriptional induction silent chromatin additional factor 2 Intermediate STAT6 A Supplementary Figure S6

13. # TSS tag (ppm) Ramos IL-4(+) 0 (0.0) Ramos IL-4(-)3 (0.1) NM_078483 （ SLC36A1) # TSS tag (ppm) BEAS2B IL-4(+) 10 (0.6) BEAS2B IL-4(-)0 (0.0) NM_017677 （ MTMR8) B STAT6 (IP) H3Ac (IP) H3K4me3 (IP) Pol II (IP) STAT6 (WCE) H3Ac (WCE) H3K4me3 (WCE) Pol II (WCE) ChIP Seq TSS Seq IL-4 (+) IL-4 (-) Supplementary Figure S6

14. NM_078483(Ramos) NM_017677(BEAS2B) IL-4(+) IL-4(-) IL-4(+) IL-4(-) WCE IL-4(+) WCE IL-4(-) TSS IL-4(+) TSS IL-4(-) H3K4me3 IL-4(+) H3K4me3 IL-4(-) H3Ac IL4(+) H3Ac IL4(-) Pol II IL-4(+) Pol II IL-4(-) Fold112.9E-52.6E-5497.4148.117.220.110.9444.55 WCE IL-4(+) WCE IL-4(-) TSS IL-4(+) TSS IL-4(-) H3K4me3 IL-4(+) H3K4me3 IL-4(-) H3Ac IL-4(+) H3Ac IL-4(-) Pol II IL-4(+) Pol II IL-4(-) Fold116.4E-57.9E-53.143.331.26.36.1 (1) (2.9E-05) (2.6E-05) (497.4) (148.1) (17.2) (20.1) (10.9) (1) (6.4E-05) (7.9E-05) (3.1) (43.3) (3) (1.2) (6.3) (6.1) (44.5) C Supplementary Figure S6

15. Supplementary Figure S6. Chromatin, pol II binding and transcriptional statuses around non-active STAT6 binding sites. (A) Schematic representation of the cases in which the chromosome status and the binding status of pol II are intermediate between active and silent target genes. Right and left panels in (B) exemplify “intermediate” binding sites represented by yellow and red shade boxes in (A), respectively. (C) Upper and lower panels represent results of validation analyses for histone modification patterns, pol II binding statuses and TSS inductions in right and left panels in (B), respectively. Numbers in parentheses represent fold induction compared to background (WCE). Note that we used the same primer set for the real time RT-PCR validations of TSS Seq and observed no positive signals from 1 ng of first strand cDNA used in Supplementary Figure S3. Supplementary Figure S6

16. Active Target in Th2 (Ramos)Active Target in Th2 (BEAS2B) H3Ac H3K4me3 Pol II H3Ac H3K4me3 Pol II Distance from TSS(bp) Average tag counts (ppm) Distance from TSS(bp) WCE IL-4(+) ChIP IL-4(-) ChIP IL-4(+) WCE IL-4(-) WCE IL-4(+) ChIP IL-4(-) ChIP IL-4(+) WCE IL-4(-) Average tag counts (ppm) A Supplementary Figure S7

17. Target in BEAS2BTarget in Th2 #total 358394 Ramos H3K4me3 (+) 322 (90%)241 (61%) Ramos H3Ac (+) 318 (89%)236 (60%) Ramos Pol II (+) 299 (84%)192 (49%) Target in RamosTarget in Th2 #total 150394 BEAS2B H3K4me3 (+) 101(67%)229 (58%) BEAS2B H3Ac (+) 90 (60%)210 (53%) BEAS2B Pol II (+) 93 (62%)178 (45%) BC Chromatin/pol II status in RamosChromatin/pol II status in BEAS2B Supplementary Figure S7. Results of the similar analysis as shown in Figure 3 (A) and Table 2B (B) in Th2 cells. (A) Chromatin and binding statuses of pol II in Ramos cells (left panels) and BEAS2B cells (right panels) around the STAT6 targets which are active in Th2 cells. (B) nd; not determined. Note transcriptional consequences of the STAT6 binding were not specified in the previous paper in Th2 cells. Supplementary Figure S7

18. Transfac IDP-valueDefinitionRefseq ID TSS Seq (ppm) (IL-4 (+)/IL-4 (-)) V$FXR_Q3 0.00077FXR1NM_00508761.3/58.6 V$CEBPGAMMA_Q60.0016 CCAAT/enhancer binding protein NM_0018063.2/0.1 V$CETS1P54_020.038 v-ets erythroblastosis virus E26 oncogene homolog 1 NM_0052382.0/0.5 Transfac IDP-valueDefinitionRefseq ID TSS Seq (ppm) (IL-4 (+)/IL-4 (-)) V$FAC1_01 2.9E-05 bromodomain PHD finger transcription factor NM_0044594.0/0.2 V$FXR_Q30.0025FXR1NM_005087122.6/66.2 V$CEBPGAMMA_Q60.0025 CCAAT/enhancer binding protein NM_0018062.0/1.9 A B Putative cooperative transcription factors in Ramos Putative cooperative transcription factors in BEAS2B Supplementary Figure S8. List of the transcription factor candidates which are likely to play roles in cell-type specific transcriptional induction in Ramos cells (A) and BEAS2B cells (B). Statistical significance of the enrichment of the consensus binding sequences in active targets is shown in the second column. Expression level evaluated by digital TSS tag counts is shown in the 5th column. Supplementary Figure S8

19. Supplementary Table S1. Sequence primers used for the validation analyses. Supplementary Table S1 Fw PrimerRv Primer ChIP for STAT6 in RamosNM_031479GCAGATGGCTGGGGTATTTACCCTACCTCCCCACTGACAC NM_021950GCCCTAAAAGTGAAGCCAGAAAGCAGGTGTGGATGGTAGG NM_004015AGTTGCGCACCTGTGTGATTGTTTTCAGCAGCACTGGAC NM_002002GCCAAGACTCAGCTCAAACACCACATCCGCACAATTTTCT NM_021150TCAAACAGACTGGAAACAACTCACACAACAGGTGCCTGTCACT NM_015226GCTGGTTTGGCTGTTCTTTCCCTCGGAAGGAAGTGCATTA NM_001006605GTGTTTTTGCTGTGGCATTGTCCCATATGGCAAGGTGAAG NM_198153GCAGGGATTCATTGAGCCTAGCCCTCTGACTGTGAGTCCT ChIP for STAT6 in BEAS2BNM_021102AGCATGAGCCCAGTGAACTTTCTTGGAAGCCTGTGGTTTT NM_001039775AAGAGACCTGACTCTGGGCAATTCCACCAGCTTCTCAGGA NM_198951ATTCCAGTCCCAGTGACCAGTGGGAAAACTGAAACCCAGA NM_145806CGTCATTTTGTGGCTTCAGACTTCACTTCCTGCCACCACT TSS in RamosNM_021950CCAACCAAAGAATGAAGAAGTCTGGAAAGTTCGTCTCTGT NM_002002TTCTGCGACCGTAAGCTGGGGTCTGGTCTTGAATCAG NM_003745CAGCGGAACTGCTTTTTGAAGGAGCTCAGGTAGTCG NM_001006605TTGGGATAATCTACCAGGTGTTCCTCTAGTTGGCTTATCAA NM_207435GTTGATGGGAACCATTTTCGAAGAACTTGTCTGGCTGTC NM_004233CTGCACAGCGTAAAGAAGAGCAAGTGAAAATGATGAGTGTT TSS in BEAS2BNM_021102AACAGCTACCGCTCTGAGGACCAGGAAGAGGATCAACACC NM_032177AAGAGGAAAATGGGCAAGGTTCGGGCTATCAGGTCTTTCT NM_014739AGGAGTTTTTGCTGGGACAACCACACCATCATCTCTGTCG NM_016530AGACAAGCGCAAAATCCAGTCTCCTGCTGAATTGCTGTCA NM_198951CTACCAGGGATCCAGCTTTGATACTCCTGCCGCTCCTCTT NM_017977CCCCACGCAGACTGTGAGTAGTCCTTGTCCCACTGTGGTC TSS in si-BEAS2BSTAT6CCTTTTGGCAGTGGTTTGATATCTGTGGAGAGCCATCCTG GAPDHTCGGAGTCAACGGATTTGGTTGACGGTGCCATGGAATTTG RamosNM_078483CTCAAGGGAGCACGTGACCTCTCGCCATCCTCCTTTGCT BEAS2BNM_017677GTTGAACCTGAACCAGAATAACTCTCGTCACCTGATCCTC BEAS2B EMSANM_003791TACTCCCAACTCTCGCGAGACTGGGCGACCGGTCGCCCAGTCTCGCGAGAGTTGGGAGTA NM_022913CTGTGCACGATCTCGCGAGACTTGGCCCAGCTGGGCCAAGTCTCGCGAGATCGTGCACAG