1. End Show Slide 1 of 32 Copyright Pearson Prentice Hall Biology

2. End Show Slide 2 of 32 Copyright Pearson Prentice Hall 13-2 Manipulating DNA

3. End Show Slide 3 of 32 Copyright Pearson Prentice Hall Interest Grabber The Smallest Scissors in the World Have you ever used your word processor’s Search function? You can specify a sequence of letters, whether it is a sentence, a word, or nonsense, and the program scrolls rapidly through your document, finding every occurrence of that sequence. How might such a function be helpful to a molecular biologist who needs to “search” DNA for the right place to divide it into pieces?

4. End Show Slide 4 of 32 Copyright Pearson Prentice Hall 1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. 3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find?

5. End Show Slide 5 of 32 Copyright Pearson Prentice Hall 1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACC TA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. 1–2: Remind students to check their copies for accuracy before they begin the next step. 3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find? Students should find three occurrences of the sequence: GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGT TAACCTA

6. End Show 13-2 Manipulating DNA Slide 6 of 32 Copyright Pearson Prentice Hall The Tools of Molecular Biology How do scientists make changes to DNA? The Tools of Molecular Biology

7. End Show 13-2 Manipulating DNA Slide 7 of 32 Copyright Pearson Prentice Hall Scientists use their knowledge of the structure of DNA and its chemical properties to study and change DNA molecules. The Tools of Molecular Biology

8. End Show 13-2 Manipulating DNA Slide 8 of 32 Copyright Pearson Prentice Hall The Tools of Molecular Biology Scientists use different techniques to: extract DNA from cells cut DNA into smaller pieces identify the sequence of bases in a DNA molecule make unlimited copies of DNA

9. End Show 13-2 Manipulating DNA Slide 9 of 32 Copyright Pearson Prentice Hall The Tools of Molecular Biology In genetic engineering, biologists make changes in the DNA code of a living organism.

10. End Show 13-2 Manipulating DNA Slide 10 of 32 Copyright Pearson Prentice Hall The Tools of Molecular Biology DNA Extraction DNA can be extracted from most cells by a simple chemical procedure. The cells are opened and the DNA is separated from the other cell parts.

11. End Show 13-2 Manipulating DNA Slide 11 of 32 Copyright Pearson Prentice Hall The Tools of Molecular Biology Cutting DNA Most DNA molecules are too large to be analyzed, so biologists cut them into smaller fragments using restriction enzymes.

12. End Show 13-2 Manipulating DNA Slide 12 of 32 Copyright Pearson Prentice Hall The Tools of Molecular Biology Each restriction enzyme cuts DNA at a specific sequence of nucleotides. Recognition sequences DNA sequence Restriction enzyme EcoR I cuts the DNA into fragments Sticky end

13. End Show 13-2 Manipulating DNA Slide 13 of 32 Copyright Pearson Prentice Hall The Tools of Molecular Biology A restriction enzyme will cut a DNA sequence only if it matches the sequence precisely. Recognition sequences DNA sequence Restriction enzyme EcoR I cuts the DNA into fragments Sticky end

14. End Show 13-2 Manipulating DNA Slide 14 of 32 Copyright Pearson Prentice Hall The Tools of Molecular Biology Separating DNA In gel electrophoresis, DNA fragments are placed at one end of a porous gel, and an electric voltage is applied to the gel. When the power is turned on, the negatively- charged DNA molecules move toward the positive end of the gel.

15. End Show 13-2 Manipulating DNA Slide 15 of 32 Copyright Pearson Prentice Hall The Tools of Molecular Biology Gel electrophoresis can be used to compare the genomes of different organisms or different individuals. It can also be used to locate and identify one particular gene in an individual's genome.

16. End Show 13-2 Manipulating DNA Slide 16 of 32 Copyright Pearson Prentice Hall The Tools of Molecular Biology DNA plus restriction enzyme Mixture of DNA fragments Gel Power source Gel Electrophoresis Longer fragments Shorter fragments

17. End Show 13-2 Manipulating DNA Slide 17 of 32 Copyright Pearson Prentice Hall The Tools of Molecular Biology First, restriction enzymes cut DNA into fragments. The DNA fragments are poured into wells on a gel. DNA plus restriction enzyme Mixture of DNA fragments Gel Gel Electrophoresis

18. End Show 13-2 Manipulating DNA Slide 18 of 32 Copyright Pearson Prentice Hall The Tools of Molecular Biology An electric voltage is applied to the gel. This moves the DNA fragments across the gel. The smaller the DNA fragment, the faster and farther it will move across the gel. Power source Gel Electrophoresis

19. End Show 13-2 Manipulating DNA Slide 19 of 32 Copyright Pearson Prentice Hall The Tools of Molecular Biology Based on size, the DNA fragments make a pattern of bands on the gel. These bands can then be compared with other samples of DNA. Longer fragments Shorter fragments Gel Electrophoresis

20. End Show 13-2 Manipulating DNA Slide 20 of 32 Copyright Pearson Prentice Hall Using the DNA Sequence Knowing the sequence of an organism’s DNA allows researchers to study specific genes, to compare them with the genes of other organisms, and to try to discover the functions of different genes and gene combinations.

21. End Show 13-2 Manipulating DNA Slide 21 of 32 Copyright Pearson Prentice Hall Using the DNA Sequence Reading the Sequence In DNA sequencing, a complementary DNA strand is made using a small proportion of fluorescently labeled nucleotides.

22. End Show 13-2 Manipulating DNA Slide 22 of 32 Copyright Pearson Prentice Hall Using the DNA Sequence DNA Sequencing DNA strand with unknown base sequence DNA fragments synthesized using unknown strand as a template Dye molecules

23. End Show 13-2 Manipulating DNA Slide 23 of 32 Copyright Pearson Prentice Hall Using the DNA Sequence Each time a labeled nucleotide is added, it stops the process of replication, producing a short color-coded DNA fragment. When the mixture of fragments is separated on a gel, the DNA sequence can be read.

24. End Show 13-2 Manipulating DNA Slide 24 of 32 Copyright Pearson Prentice Hall Using the DNA Sequence Base sequence as “read” from the order of the dye bands on the gel from bottom to top: T G C A C Electrophoresis gel

25. End Show 13-2 Manipulating DNA Slide 25 of 32 Copyright Pearson Prentice Hall Using the DNA Sequence Cutting and Pasting Short sequences of DNA can be assembled using DNA synthesizers. “Synthetic” sequences can be joined to “natural” sequences using enzymes that splice DNA together.

26. End Show 13-2 Manipulating DNA Slide 26 of 32 Copyright Pearson Prentice Hall Using the DNA Sequence These enzymes also make it possible to take a gene from one organism and attach it to the DNA of another organism. Such DNA molecules are sometimes called recombinant DNA.

27. End Show 13-2 Manipulating DNA Slide 27 of 32 Copyright Pearson Prentice Hall Using the DNA Sequence Making Copies Polymerase chain reaction (PCR) is a technique that allows biologists to make copies of genes. A biologist adds short pieces of DNA that are complementary to portions of the sequence.

28. End Show 13-2 Manipulating DNA Slide 28 of 32 Copyright Pearson Prentice Hall Using the DNA Sequence DNA is heated to separate its two strands, then cooled to allow the primers to bind to single-stranded DNA. DNA polymerase starts making copies of the region between the primers.

29. End Show 13-2 Manipulating DNA Slide 29 of 32 Copyright Pearson Prentice Hall Using the DNA Sequence DNA heated to separate strands PCR cycles DNA copies 12345 etc. 124816 etc. Polymerase Chain Reaction (PCR) DNA polymerase adds complementary strand DNA fragment to be copied

30. End Show - or - Continue to: Click to Launch: Slide 30 of 32 Copyright Pearson Prentice Hall 13-2

31. End Show Slide 31 of 32 Copyright Pearson Prentice Hall 13-2 Restriction enzymes are used to a.extract DNA. b.cut DNA. c.separate DNA. d.replicate DNA.

32. End Show Slide 32 of 32 Copyright Pearson Prentice Hall 13-2 During gel electrophoresis, the smaller the DNA fragment is, the a.more slowly it moves. b.heavier it is. c.more quickly it moves. d.darker it stains.

33. End Show Slide 33 of 32 Copyright Pearson Prentice Hall 13-2 The DNA polymerase enzyme Kary Mullis found in bacteria living in the hot springs of Yellowstone National Park illustrates a.genetic engineering. b.the importance of biodiversity to biotechnology. c.the polymerase chain reaction. d.selective breeding.

34. End Show Slide 34 of 32 Copyright Pearson Prentice Hall 13-2 A particular restriction enzyme is used to a.cut up DNA in random locations. b.cut DNA at a specific nucleotide sequence. c.extract DNA from cells. d.separate negatively charged DNA molecules.

35. End Show Slide 35 of 32 Copyright Pearson Prentice Hall 13-2 During gel electrophoresis, DNA fragments become separated because a.multiple copies of DNA are made. b.recombinant DNA is formed. c.DNA molecules are negatively charged. d.smaller DNA molecules move faster than larger fragments.

36. END OF SECTION