1. FUSARIUM STRAIN IDENTIFICATION IN DIFFERENT WHEAT SAMPLES COLLECTED FROM DIFFERENT REGIONS FROM THE WEST PART OF ROMANIA

2. Fusarium graminearum, Fusarium culmorum Deoxynivalenol (DON) and Nivalenol (NIV) Fusarium verticillioides and Fusarium proliferatum Fumonisin two chemotaxonomic groups based on production of trichothecenes:

3. Many of the trichothecene biosynthesis genes are localized in a gene cluster of at least 10 genes. The genes in this cluster include the genes for: trichodiene synthetase (Tri5) P450 oxygenase (Tri4 and Tri11) acetyltransferase (Tri3 and Tri7) transcription factors (Tri6 and Tri10) a toxin efflux pump (Tri12) two unidentified hypothetical proteins (Tri8 and Tri9) another acetyltransferase gene (Tri101) is unlinked to the cluster the genes Tri13 and Tri14, were found to be under the control of Tri10, but the functions of these genes are not known TRICHOTHECENES ARE BIOSYNTHESIZED IN A COMPLEX PATHWAY INVOLVING A SERIES OF OXYGENATION, ISOMERIZATION, AND ESTERIFICATION STEPS

4. SpeciePrimers sequenceAmplicon size (bp) Tri 7 DON biosynthetic gene 5’ TGCGTGGCAATATCTTCTTCCTA 3’ 3’ GTGCTAATATTGTGCTAATATTGTGC 5’ 381-445 Tri 13 DON biosynthetic gene 5’ CATCATGAGACTTGTGTCAGAGTTTGGG 3’ 3’ GCTAGATCGATTGTTGCATTGAG 5’ 282 Tri 7 NIV biosynthetic gene 5’ TGCGTGGCAATATCTTCTTCTA 3’ 3’ GGTTCAAGTAACGTTCGACAATAG 5’ 465 Tri13 NIV biosynthetic gene 5’ CCAAATCCGAAAACCGCAG 3’ 3‘ TTGAAAGCTCCAATGTCGTG 5’ 312 FUM 1(PQF5) fumonisin biosynthetic gene 5’ GAGCCGAGTCAGCAAGGATT 3’ 3’ AGGGTTCGTGAGCCAAGGA 5’ 60 Primers for the toxin genes

5. The DON level in conventional and GMO maize seeds - 2009 THE TOXIN LEVEL IN CONVENTIONAL AND GMO MAIZE – in previous years

6. The fumonisin level in conventional and GMO maize seeds - 2009

7. DON 2008 –– low levels for GMO (114,91µg/kg) and conventional (127.09 µg/kg) maize 2009 – the average level for DON was 25 times higher (971,44 µg/kg) compared to GMO (38,59 µg/kg) FUMONISIN The differences between conventional corn (800 µg/kg) and Bt (512,8 µg/kg) were lower in 2008, compared to 2009 - 1162,01 µg/kg for conventional maize and 462,8 µg/kg for GMO. Significant variation of the mycotoxins concentration among places, years and genotypes has been reported in other countries, too

8. 1 2 3 4 5 PC Fusarium graminearum 1 2 3 4 5 PC NC Fusarium proliferatum Fusarium verticiloides - negatives 600 bp MAIZE – conventional and genetically modified - 2010 Fusarium culmorum 1-4 conventional maize 5- Bt (GMO) maize Fusarium DETECTION

9. 1 2 3 4 5 PC TRI 7 DON 1 2 3 4 5 PC TRI 13 DON TRI 7 NIV - negative PQF5 – fumonisin - negative TOXIN GENES DETECTION

10. WHEAT SAMPLES, collected from last year’s harvest 1 – Fizes Caras Severin county 2 – Sacalaz – Timis county 3 – Beregsau Mare – Timis county 4 – Becicherecu Mic – Timis county 5 – Pecica – Arad county 6 – Ineu – Arad county 7- Barsa – Arad county

11. Fusarium proliferatum Fusarium graminearum 1 2 3 4 5 6 7 Fusarium culmorum Fusarium verticiloides - negatives Fusarium DETECTION

12. 1 2 3 4 5 6 7 TRI 7 DON TRI 13 DON TRI 7 NIV PQF5 – fumonisin - negative TOXIN GENES DETECTION

13. In general, both DON and NIV chemotypes were reported in Africa, Asia and Europe, while only the DON chemotype was found in the USA SampleFgFcFpFv TRI 7 DON TRI 13 DON TRI 7 NIV PQF5 1Fizes - Caras Severin county+--++-- 2Sacalaz – Timis county+-+-++-- 3Beregsau Mare – Timis county+--++-- 4Becicherecu Mic – Timis county+--+-+- 5Pecica – Arad county+--+++- 6Ineu – Arad county+--+++- 7Barsa – Arad county+--++-- The Fusarium presence and toxin producing genes

14. THE HEAVY METALS INFLUENCE ON TWO ALFALFA GENOTYPES – A SENSITIVE AND A TOLERANT ONE

15. Germination on moistened filter paper The plantlets were transferred in pots (1 week) The metal treatments were applied after 1 month Pb and Cd Cu and Fe

16. Untreated - control Pb50Cd1Cu100Fe100 3250 10500 20 First experimental serie The Cu and Fe concentration were too high

17. Pb Cd Cu Fe Pb Cd Cu Fe

18. Second experimental serie (ppm concentration) Untreated - control Pb50Cd1Cu 5 Fe 5 1003 10 25010 50 SIGMA SATELIT Two month treatment

19. LSD 5% LSD 1% LSD 0.1 % 25.9734.2744.02 The significance of differences between different variants applied to Sigma alfalfa cultivar No. VariantsGrowth rate (%) To experimental mean To control after 1 week Relative value (%) Differ./ Signiff. Relative value (%) Differ./ Signiff. 1 Control125.95+7.8487.04-18.76100.00Control 2 Pb 50131.92+11.1691.16-12.79104.745.97 3 Pb 100148.09+11.97102.343.38117.5822.14 4 Pb 250138.49+14.7495.70-6.22109.9612.54 5 Cd 1153.79+11.37106.289.08122.1027.84* 6 Cd 3163.95+13.99113.3019.24130.1738.00** 7 Cd 10150.96+15.67104.326.25119.8625.01 8 Cu 5152.41+18.04105.327.70121.0126.46* 9 Cu 10137.04+14.5094.70-7.67108.8111.09 10 Cu 50125.12+7.0686.46-19.5999.34-0.83 11 Fe 5158.4+12.86109.4613.69125.7632.45* 12 Fe 10150.61+12.17104.085.90119.5824.66 13 Fe 50144.48+12.3699.84-0.23114.7118.53 Exp. mean144.71+9.12100.00Control114.8918.76 The highest values of the growth rate with statistic significance were observed after one week for the variants: Cd 3 (38,00**); Fe 5 (32,45*); Cd 1 (27,84*) şi Cu 5 (26,46*). One week SIGMA

20. The significance of differences between different variants applied to Sigma alfalfa cultivar One month No. Variants Growth rate (%) To experimental mean To control after 1 month Relative value (%) Differ./ Signiff. Relative value (%) Differ./ Signiff. 1 Control152.59+11.6693.69-10.27100.00Control 2 Pb 50151.88+13.5693.26-10.9899.53-0.71 3 Pb 100162.43+13.8599.74-0.43106.459.84 4 Pb 250150.71+14.9992.54-12.1598.77-1.88 5 Cd 1174.85+13.79107.3611.99114.5922.26 6 Cd 3189.77+20.56116.5226.91124.3737.18 7 Cd 10192.35+22.81118.1129.49126.0639.76 8 Cu 5183.19+20.94112.4820.33120.0530.60 9 Cu 10145.82+16.2489.54-17.0495.56-6.77 10 Cu 500.00+0.000.00-162.86 000 0.00-152.59 000 11 Fe 5224.59+28.11137.9061.73**147.1972.00** 12 Fe 10203.54+21.94124.9840.68133.3950.95* 13 Fe 50185.52+20.79113.9122.66121.5832.93 Exp. mean162.86+15.05100.00Control106.7310.27 LSD 5% LSD 1% LSD 0.1 % 42.5956.2172.21 Compared to the untreated variant, a positive evolution of the growth rate was pointed out for the Fe 5, Cd10 and Cu 5 variants, the increasing being statistically significant only for Fe 5 variant. Compared to the untreated variant, after one month treatment a superior growth rate was pointed out for all of the variants, except the variants Pb50, Pb250, Cu 10 and Cu 50. The growth was statistical significant only for Fe 5 and Fe 10.

21. Growth rate after 1 week and 1 month after treatment with different metals of Sigma alfalfa cultivar

22. No. Variants Growth rate (%) To experimental meanTo control after 1 week Relative value (%) Differ./ Signiff. Relative value (%) Differ./ Signiff. 1 Control120.68+6.5888.89-15.09100.00Control 2 Pb 50159.80+25.99117.7024.03132.4239.12** 3 Pb 100108.60+8.4479.99-27.1789.99-12.08 4 Pb 250120.65+9.1088.86-15.1299.98-0.03 5 Cd 1141.81+19.05104.456.04117.5121.13 6 Cd 3152.27+16.58112.1516.50126.1831.59* 7 Cd 10145.30+14.39107.029.53120.4024.62 8 Cu 5158.87+22.57117.0123.10131.6538.19* 9 Cu 10111.89+6.7382.41-23.8892.72-8.79 10 Cu 50137.87+28.93101.552.10114.2417.19 Exp. mean 135.77+6.03100.00Control112.5115.09 LSD 5% LSD 1% LSD 0.1 % 29.1938.5249.48 The significance of differences between different variants applied to Satelit alfalfa cultivar Compared to the untreated variant, most of the variants, except Pb 100, Pb 250 şi Cu 10, had a positive influence on the growth rate. The highest values, statistically significant, were pointed out for the variants Pb50 (39,12**), Cu 5 (38,19*) şi Cd 3 (31,59*). One week

23. No. Variant s Growth rate (%) To experimental meanTo control after 1 month Relative value (%) Differ./ Signiff. Relative value (%) Differ./ Signiff. 1 Control153.54+21.4495.85-6.65100.00Control 2 Pb 50171.66+18.71107.1611.47111.8018.12 3 Pb 100203.57+32.56127.0843.38132.5850.03* 4 Pb 250172.30+19.08107.5612.11112.2218.76 5 Cd 1177.37+21.03110.7217.18115.5223.83 6 Cd 3201.41+26.06125.7341.22131.1847.87* 7 Cd 10169.32+15.09105.709.13110.2815.78 8 Cu 5211.90+30.14132.2851.71*138.0158.36* 9 Cu 10140.85+12.8387.93-19.3491.74-12.69 10 Cu 500.00+0.000.00-160.19 000 0.00-153.54 000 Exp. mean 160.19+19.14100.00Control104.336.65 LSD 5% LSD 1% LSD 0.1 % 44.7359.0375.83 The significance of differences between different variants applied to Satelit alfalfa cultivar One month Compared to the untreated variant, a superior growth rate was pointed out for all of the variants, except Cu 10. The highest values, statistically significant were register for the variants: Cu 5 (58,36*); Pb 100 (50,03*) şi Cd 3 (47,87*). Compared to the experience mean, all the treatments, except Pb 50 and the control, had a positive and progressive effect in time.The same trend was observed compared to the untreated variant, too.

24. Growth rate after 1 week and 1 month after treatment with different metals of Satelit alfalfa cultivar

25. Growth rate for studied alfalfa cultivar 1 week after treatment with different metals Considering the interaction genotype x treatment, after one week treatment we observed significant differences between the growth rate of the two alfalfa genotypes for the following treatments: Pb 50, Pb 100, Pb 250 şi Cu 10.

26. Growth rate for studied alfalfa cultivar 1 month after treatment with different metals After one month treatment the effect of the interaction genotype x treatment on the growth rate was reduced, statistically significant differences being observed only for Pb 100 and Cu 5 variants.

27. THANK YOU FOR YOUR ATTENTION !