Presentation is loading. Please wait.

Presentation is loading. Please wait.

CHMI 2227 - E.R. Gauthier, Ph.D. 1 CHMI 2227E Biochemistry I Nucleic acids: - replication.

Published byLaurel Barnett Modified over 8 years ago

Similar presentations

Presentation on theme: "CHMI 2227 - E.R. Gauthier, Ph.D. 1 CHMI 2227E Biochemistry I Nucleic acids: - replication."— Presentation transcript:

1 CHMI 2227 - E.R. Gauthier, Ph.D. 1 CHMI 2227E Biochemistry I Nucleic acids: - replication

2 CHMI 2227 - E.R. Gauthier, Ph.D.2 DNA replication Nucleus DNA

3 CHMI 2227 - E.R. Gauthier, Ph.D.3 DNA replication 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’ 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’ 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’

4 CHMI 2227 - E.R. Gauthier, Ph.D.4 DNA replication

5 CHMI 2227 - E.R. Gauthier, Ph.D.5 Semi-conservative Conservative Dispersive Non-conservative DNA replication 1) Conservation of the parental strands

6 CHMI 2227 - E.R. Gauthier, Ph.D.6 DNA replication 1) The Meselson and Stahl experiment PNAS 1958;44;671-682

7 CHMI 2227 - E.R. Gauthier, Ph.D.7 DNA replication 2) Directionality of replication Replication forks

8 CHMI 2227 - E.R. Gauthier, Ph.D.8 DNA replication The replication fork 3’ Replication fork 5’ 3’ 5’ 3’ 5’ Direction of the replication fork

9 CHMI 2227 - E.R. Gauthier, Ph.D.9 DNA replication Large DNA molecules can have multiple origins of replication

10 CHMI 2227 - E.R. Gauthier, Ph.D.10 DNA replication 2) Directionality of replication 5’ 3’ 5’ 3’ 5’

11 CHMI 2227 - E.R. Gauthier, Ph.D.11 DNA replication 2) Directionality of replication

12 CHMI 2227 - E.R. Gauthier, Ph.D.12 DNA replication 2) Directionality: Okazaki fragments

13 CHMI 2227 - E.R. Gauthier, Ph.D.13 DNA replication The replication fork

14 CHMI 2227 - E.R. Gauthier, Ph.D.14 DNA replication 3) Nature of the replication machinery

15 CHMI 2227 - E.R. Gauthier, Ph.D.15 DNA replication 3) DNA polymerase

16 CHMI 2227 - E.R. Gauthier, Ph.D.16 DNA replication 3) DNA polymerase

17 CHMI 2227 - E.R. Gauthier, Ph.D.17 DNA replication 3) DNA polymerase

18 CHMI 2227 - E.R. Gauthier, Ph.D.18 DNA replication 3) DNA polymerase III of E. coli

19 CHMI 2227 - E.R. Gauthier, Ph.D.19 DNA replication 3) DNA polymerase III of E. coli (Clamp loader) (DNA polymerase)

20 CHMI 2227 - E.R. Gauthier, Ph.D.20 DNA replication 3) DNA polymerase III of E. coli http://oregonstate.edu/instruction/bb492/figletters/FigG1.html

21 CHMI 2227 - E.R. Gauthier, Ph.D.21 DNA replication 3) DNA polymerase III of E. coli Sliding clamp Put DNA Here! Direction of replication

22 CHMI 2227 - E.R. Gauthier, Ph.D.22 DNA replication 3) Primase

23 CHMI 2227 - E.R. Gauthier, Ph.D.23 DNA replication Initiation at the origin of replication

24 CHMI 2227 - E.R. Gauthier, Ph.D.24 DNA replication Leading strand synthesis http://oregonstate.edu/instruction/bb492/figletters/FigH4.html Unwinds DNA

25 CHMI 2227 - E.R. Gauthier, Ph.D.25 DNA replication Lagging strand synthesis

26 CHMI 2227 - E.R. Gauthier, Ph.D.26 DNA replication Lagging strand

27 CHMI 2227 - E.R. Gauthier, Ph.D.27 DNA replication - DNA ligase Lacking Phosphodiester bond

28 CHMI 2227 - E.R. Gauthier, Ph.D.28 DNA replication 4) Proofreading

29 CHMI 2227 - E.R. Gauthier, Ph.D.29 DNA replication 4) Proofreading

30 CHMI 2227 - E.R. Gauthier, Ph.D.30 DNA sequencing

31 CHMI 2227 - E.R. Gauthier, Ph.D.31 PCR

32 CHMI 2227 - E.R. Gauthier, Ph.D.32 PCR

33 CHMI 2227 - E.R. Gauthier, Ph.D.33

Download ppt "CHMI 2227 - E.R. Gauthier, Ph.D. 1 CHMI 2227E Biochemistry I Nucleic acids: - replication."

Similar presentations

DNA replication accuracy Balance between accuracy and mutation (to allow evolution) About 1 mistake per 10 9 - 10 12 basepairs Achieved by accuracy of.

DNA replication accuracy Balance between accuracy and mutation (to allow evolution) About 1 mistake per basepairs Achieved by accuracy of.
DNA Structure & Replication Chapter 15 continued Bedford County Public Schools – Jami N. Key.

DNA Structure & Replication Chapter 15 continued Bedford County Public Schools – Jami N. Key.
1 Review of directionality in DNA Now, for DNA replication.

1 Review of directionality in DNA Now, for DNA replication.
1 Replication of the Genetic Material Genetic material must be duplicated for transfer into daughter cells. Complementary double-stranded DNA makes this.

1 Replication of the Genetic Material Genetic material must be duplicated for transfer into daughter cells. Complementary double-stranded DNA makes this.
IB Topics 3 and 7.  DNA replication is a means to produce new molecules that have the same base sequence  Occurs during interphase of the cell cylce.

IB Topics 3 and 7.  DNA replication is a means to produce new molecules that have the same base sequence  Occurs during interphase of the cell cylce.
Chapter 13 DNA Replication.

Chapter 13 DNA Replication.
Replication of Nucleic Acids. 2 Because sometimes this... 3.

Replication of Nucleic Acids. 2 Because sometimes this... 3.
DNA Replication. Synthesis Phase (S phase) S phase in interphase of the cell cycle. Nucleus of eukaryotes Mitosis -prophase -metaphase -anaphase -telophase.

DNA Replication. Synthesis Phase (S phase) S phase in interphase of the cell cycle. Nucleus of eukaryotes Mitosis -prophase -metaphase -anaphase -telophase.
DNA The Molecule of Life: Replication. Replication: Why? When cells replicate, each new cell needs it’s own copy of DNA. Where? Nucleus in Eukaryotes.

DNA The Molecule of Life: Replication. Replication: Why? When cells replicate, each new cell needs it’s own copy of DNA. Where? Nucleus in Eukaryotes.
CHMI 2227 - E.R. Gauthier, Ph.D. 1 CHMI 2227E Biochemistry I Nucleic acids: - replication.

CHMI E.R. Gauthier, Ph.D. 1 CHMI 2227E Biochemistry I Nucleic acids: - replication.
AP Biology 2007-2008 DNA Replication Ch.12.2 AP Biology DNA Replication  Purpose: cells need to make a copy of DNA before dividing so each daughter.

AP Biology DNA Replication Ch.12.2 AP Biology DNA Replication  Purpose: cells need to make a copy of DNA before dividing so each daughter.
1. What experiment proved the semi- conservative replication nature of DNA? 2. What are the 3 steps of the DNA replication process? 3. What proteins help.

1. What experiment proved the semi- conservative replication nature of DNA? 2. What are the 3 steps of the DNA replication process? 3. What proteins help.
DNA Replication and Repair. How does DNA replicate? Mitosis and meiosis require DNA to replicate itself so that the daughter cells will contain DNA But.

DNA Replication and Repair. How does DNA replicate? Mitosis and meiosis require DNA to replicate itself so that the daughter cells will contain DNA But.
Ch. 12.2: Replication of DNA Section objective:

Ch. 12.2: Replication of DNA Section objective:
DNA REPLICATION. What does it mean to replicate? The production of exact copies of complex molecules, such as DNA molecules, that occurs during growth.

DNA REPLICATION. What does it mean to replicate? The production of exact copies of complex molecules, such as DNA molecules, that occurs during growth.
Replication of DNA Objectives: 1. Summarize the roles of the different enzymes involved in replication of DNA. 2. Explain how the leading and lagging strands.

Replication of DNA Objectives: 1. Summarize the roles of the different enzymes involved in replication of DNA. 2. Explain how the leading and lagging strands.
Animations/websites 878/student/animations/dna_replication/inde x.html

Animations/websites 878/student/animations/dna_replication/inde x.html
(b) Separation of strands

(b) Separation of strands
DNA Replication IB Biology HL 1 Mrs. Peters Spring 2014.

DNA Replication IB Biology HL 1 Mrs. Peters Spring 2014.
DNA Replication!.

DNA Replication!.

Similar presentations

Ads by Google