1. CHMI 2227 - E.R. Gauthier, Ph.D. 1 CHMI 2227E Biochemistry I Nucleic acids: - replication

2. CHMI 2227 - E.R. Gauthier, Ph.D.2 DNA replication The cell cycle defines a series of events required for the division of a cell into two progeny:  S phase: duplication of DNA  M phase: mitosis  Gap phases (G1 and G2): preparation for S or M; Nucleus DNA

3. CHMI 2227 - E.R. Gauthier, Ph.D.3 DNA replication During DNA replication, a DNA molecule is copied into 2 progeny molecules following the basic Watson-Crick rules:  Complementarity of the two strands (i.e. base pairing)  Antiparallelism (i.e. strands run in opposite 5’  3’ directions); 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’ 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’ 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’

4. CHMI 2227 - E.R. Gauthier, Ph.D.4 DNA replication Questions to answer:  1) Conservation of the parental strands?  2) Directionality of DNA synthesis?  3) Nature of the machinery for DNA synthesis?  4) Presence of proofreading?

5. CHMI 2227 - E.R. Gauthier, Ph.D.5 Semi-conservative Conservative Dispersive Non-conservative DNA replication 1) Conservation of the parental strands In theory, DNA replication can occur through different mechanisms, depending on how the parental strands are distributed among the daughter molecules;

6. CHMI 2227 - E.R. Gauthier, Ph.D.6 DNA replication 1) The Meselson and Stahl experiment PNAS 1958;44;671-682

7. CHMI 2227 - E.R. Gauthier, Ph.D.7 DNA replication 2) Directionality of replication Studies using electron microscopy revealed that the replication of bacterial DNA molecules occurs bidirectionally:  Both strands are duplicated at the same time  The site where replication occurs is called the replication fork;  The parental strand is denatured at the replication fork;  Replication starts at a specific point: the origin of replication Replication forks

8. CHMI 2227 - E.R. Gauthier, Ph.D.8 DNA replication The replication fork 3’ Replication fork 5’ 3’ 5’ 3’ 5’ Direction of the replication fork

9. CHMI 2227 - E.R. Gauthier, Ph.D.9 DNA replication Large DNA molecules can have multiple origins of replication

10. CHMI 2227 - E.R. Gauthier, Ph.D.10 DNA replication 2) Directionality of replication BUT: how is replication preformed with respect to the polarity of the DNA strands? In other words, is DNA replication occuring:  From the 5’ end towards the 3’ end, OR  From the 3’ end towards the 5’ end, OR  Does it matter at all??? 5’ 3’ 5’ 3’ 5’

11. CHMI 2227 - E.R. Gauthier, Ph.D.11 DNA replication 2) Directionality of replication In all living organisms, DNA replication is always performed in the 5’  3’ direction:  The progeny strand is elongated by the addition of new nucleotides at its 3’ end

12. CHMI 2227 - E.R. Gauthier, Ph.D.12 DNA replication 2) Directionality: Okazaki fragments

13. CHMI 2227 - E.R. Gauthier, Ph.D.13 DNA replication The replication fork

14. CHMI 2227 - E.R. Gauthier, Ph.D.14 DNA replication 3) Nature of the replication machinery Requirement for DNA replication:  DNA template (i.e. the parent DNA molecule);  All 4 deoxynucleotide triphosphates (dNTPs: dATP, dGTP, dCTP, dTTP);  DNA polymerase (an enzyme)  A DNA or RNA primer to jump start DNA replication;

15. CHMI 2227 - E.R. Gauthier, Ph.D.15 DNA replication 3) DNA polymerase

16. CHMI 2227 - E.R. Gauthier, Ph.D.16 DNA replication 3) DNA polymerase The role of DNA polymerase is only to catalyse the formation of the phosphodiester bond. It has NOTHING to do with base pairing (well….almost nothing); Processivity: number of phosphodiester bonds synthesized by the polymerase before it loses its grip on the DNA molecule.

17. CHMI 2227 - E.R. Gauthier, Ph.D.17 DNA replication 3) DNA polymerase

18. CHMI 2227 - E.R. Gauthier, Ph.D.18 DNA replication 3) DNA polymerase III of E. coli

19. CHMI 2227 - E.R. Gauthier, Ph.D.19 DNA replication 3) DNA polymerase III of E. coli (Clamp loader) (DNA polymerase)

20. CHMI 2227 - E.R. Gauthier, Ph.D.20 DNA replication 3) DNA polymerase III of E. coli http://oregonstate.edu/instruction/bb492/figletters/FigG1.html

21. CHMI 2227 - E.R. Gauthier, Ph.D.21 DNA replication 3) DNA polymerase III of E. coli Sliding clamp Put DNA Here! Direction of replication

22. CHMI 2227 - E.R. Gauthier, Ph.D.22 DNA replication 3) Primase DNA polymerase III can only work if there is a 3’OH available to catalyse the formation of the phosphodiester bond; In other words: before DNA pol can act, DNA synthesis must already be initiated…WHAT?? This 3’OH is provided by an RNA synthetizing enzyme called DNA primase. DNA primase synthetizes a short (10 nt) RNA primer complementary to the DNA template; DNA pol I replaces the RNA primer by DNA;

23. CHMI 2227 - E.R. Gauthier, Ph.D.23 DNA replication Initiation at the origin of replication

24. CHMI 2227 - E.R. Gauthier, Ph.D.24 DNA replication Leading strand synthesis http://oregonstate.edu/instruction/bb492/figletters/FigH4.html Unwinds DNA

25. CHMI 2227 - E.R. Gauthier, Ph.D.25 Occurs exactly like leading strand synthesis, with the exception that a DNA primase periodically synthesizes an RNA primer; DNA replication Lagging strand synthesis

26. CHMI 2227 - E.R. Gauthier, Ph.D.26 DNA replication Lagging strand

27. CHMI 2227 - E.R. Gauthier, Ph.D.27 DNA replication - DNA ligase Lacking Phosphodiester bond

28. CHMI 2227 - E.R. Gauthier, Ph.D.28 DNA replication 4) Proofreading

29. CHMI 2227 - E.R. Gauthier, Ph.D.29 DNA replication 4) Proofreading

30. CHMI 2227 - E.R. Gauthier, Ph.D.30 DNA sequencing

31. CHMI 2227 - E.R. Gauthier, Ph.D.31 PCR

32. CHMI 2227 - E.R. Gauthier, Ph.D.32 PCR

33. CHMI 2227 - E.R. Gauthier, Ph.D.33