1. The 3 rd Research on Theorem Proving MEC Meeting Hanyang University Proteome Research Lab Hanyang University Proteome Research Lab 2003. 1. 16 Park, Ji-Yoon Park, Ji-Yoon

2. The 1 st Year Research - Linear Implementation

3. Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ 3 2003. 1. 16 Theorem Proving using Resolution Refutation Nil, add R as

4. Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ 4 2003. 1. 16 PrimerSequenceLengthModification GC Content ( % ) ST ¬ Q 5 ’ - AAG CAG TAG CGA CCA ATT GAC GCA AAT TGA CGT ACG TAC GCT GAA - 3 ’ 45 mer None46.7 ¬ RPQ 5 ’ - CAT ACA ATG AAC GCA GTC AAC GCA AGG CAG TTC AGC GTA CGT ACG - 3 ’ 45 mer None51.1 ¬P¬P¬P¬P 5 ’ - CTG CCT TGC GTT GAC - 3 ’ 15 mer 5 ’ -phosphate 60.0 R 5 ’ - TGC GTT CAT TGT ATG – 3 ’ 15 mer 5 ’ -phosphate 40.0 ¬S¬S¬S¬S 5 ’ - TGG TCG CTA CTT – 3 ’ 15 mer 5 ’ -phosphate 53.3 ¬T¬T¬T¬T 5 ’ - TCA ATT TGC GTC AAT-3 ’ 15 mer 5 ’ -phosphate 33.3 The Sequence for Linear Implementation

5. Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ 5 2003. 1. 16 587 540 504 458 434 267 234 213 192 184 124/123 104 89/80 64/57/51/ 21/18/11/8 75 bp 75 bp M 1 2 The Amplification of Linear Molecule Fig 1. The amplification of linear molecule in 3% agarose gel electrophoresis Lane 1: PCR product with S and ¬R Lane 2: PCR products with ¬ S and R Lane M is a 25 bp molecular DNA ladder

6. The 2 nd Year Research - Hairpin Implementation

7. Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ 7 2003. 1. 16 Sequence for Hairpin Implementation 5mer5mer 6 mer ¬P P ¬Q Q

8. Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ 8 2003. 1. 16 Primer Sequence(5 ’ → 3’) LengthModification GC Content ( % ) P TATTAAGACTTCTTGTAGTCT TATTAAGACTTCTTGTAGTCT 21 mer 5 ’ -Phosphate 28.5 Q TCATGTTCCT TCATGTTCCT 10 mer 5 ’ -Phosphate 40.0 ¬P¬P¬P¬P TAATAAGGAA 10 mer 5 ’ -Phosphate 5 ’ -Phosphate20.0 ¬Q¬Q¬Q¬Q CATGA 5 mer 5 ’ -phosphate 40.0 ¬R¬R¬R¬R TCATGTTCCT 10 mer 5 ’ -phosphate 33.3 The Sequence for Hairpin Implementation

9. Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ 9 2003. 1. 16 The Amplification of Hairpin Molecule Fig 2. The amplification of hairpin molecule in 3% agarose gel electrophoresis 50 bp 25 bp

10. The 3 rd Year Plan

11. Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ 11 2003. 1. 16 Design of Problem 6 variables, 9 clauses 6 variables, 9 clauses

12. Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ 12 2003. 1. 16 One of Proof Trees P 11 ∨ P 12 ~P 12 ∨ ~P 22 P 11 ∨ ~P 22 P 21 ∨ P 22 P 11 ∨ P 21 ~P 21 ∨ ~P 31 P 11 ∨ ~P 31 P 31 ∨ P 32 P 11 ∨ P 32 ~P 12 ∨ ~P 32 P 11 ∨ ~P 12 P 11 ∨ P 12 P 11 ~P 11 ∨ ~P 21 P 21 ∨ P 22 ~P 11 ∨ P 22 ~P 22 ∨ ~P 32 ~P 11 ∨ ~P 32 P 31 ∨ P 32 ~P 11 ∨ P 31 ~P 11 ∨ ~P 31 ~P 11 nil 20~30

13. Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ 13 2003. 1. 16 Experimental Procedure The Problem (6var, 9clau) Design of Oligo Sequence Exonuclease III (remove partial solution) Step I Step II Step III Step IV Step V Hybridization (95°C→16°C cooling down) Synthesis & Modification (5’-Phosphate) Ligation (T4 DNA Ligase: 16°C Step VI Step VII Gel Electrophoresis Step VIII The Final Solution * No Self-Homology * No Cross-Homology

14. Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ 14 2003. 1. 16 Forward Direction DNA9 Conference DNA9 Conference Abstract Submission(2/15) Abstract Submission(2/15) Experimental Work Experimental Work Journal Version Journal Version Biochemical Journal Biochemical Journal Biological Computing Biological Computing 6.373 7.666 3.161 4.493 5.54529.49136.242 24.595 10.896

15. Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ 15 2003. 1. 16 Expected Result Fragments of linear DNA migrate through agarose gels with a mobility that is inversely proportional to the log 10 of their molecular weight Fragments of linear DNA migrate through agarose gels with a mobility that is inversely proportional to the log 10 of their molecular weight Circular forms of DNA migrate in agarose distinctly differently from linear DNAs of the same mass. Circular forms of DNA migrate in agarose distinctly differently from linear DNAs of the same mass.

16. Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ Advanced Proteome Research Lab(APRL) http://gene.hanyang.ac.kr/ 16 2003. 1. 16 Discussion