Presentation is loading. Please wait.

Presentation is loading. Please wait.

The genetic code. Each amino acid is specified by a triplet of nucleotides, known as a codon. The Genetic Code.

Similar presentations


Presentation on theme: "The genetic code. Each amino acid is specified by a triplet of nucleotides, known as a codon. The Genetic Code."— Presentation transcript:

1 The genetic code

2 Each amino acid is specified by a triplet of nucleotides, known as a codon. The Genetic Code

3 TTT Phe TCT Ser TAT Tyr TGT Cys TTC Phe TCC Ser TAC Tyr TGC Cys TTA Leu TCA Ser TAA Och TGA Umb TTG Leu TCG Ser TAG Amb TGG Trp CTT Leu CCT Pro CAT His CGT Arg CTC Leu CCC Pro CAC His CGC Arg CTA Leu CCA Pro CAA Gln CGA Arg CTG Leu CCG Pro CAG Gln CGG Arg ATT Ile ACT Thr AAT Asn AGT Ser ATC Ile ACC Thr AAC Asn AGC Ser ATA Ile ACA Thr AAA Lys AGA Arg ATG Met ACG Thr AAG Lys AGG Arg GTT Val GCT Ala GAT Asp GGT Gly GTC Val GCC Ala GAC Asp GGC Gly GTA Val GCA Ala GAA Glu GGA Gly GTG Val GCG Ala GAG Glu GGG Gly The Genetic Code

4 TTT Phe TCT Ser TAT Tyr TGT Cys TTC Phe TCC Ser TAC Tyr TGC Cys TTA Leu TCA Ser TAA Och TGA Umb TTG Leu TCG Ser TAG Amb TGG Trp CTT Leu CCT Pro CAT His CGT Arg CTC Leu CCC Pro CAC His CGC Arg CTA Leu CCA Pro CAA Gln CGA Arg CTG Leu CCG Pro CAG Gln CGG Arg ATT Ile ACT Thr AAT Asn AGT Ser ATC Ile ACC Thr AAC Asn AGC Ser ATA Ile ACA Thr AAA Lys AGA Arg ATG Met ACG Thr AAG Lys AGG Arg GTT Val GCT Ala GAT Asp GGT Gly GTC Val GCC Ala GAC Asp GGC Gly GTA Val GCA Ala GAA Glu GGA Gly GTG Val GCG Ala GAG Glu GGG Gly ATG Met Single methionine codon acts as initiator The Genetic Code

5 TTT Phe TCT Ser TAT Tyr TGT Cys TTC Phe TCC Ser TAC Tyr TGC Cys TTA Leu TCA Ser TAA Och TGA Umb TTG Leu TCG Ser TAG Amb TGG Trp CTT Leu CCT Pro CAT His CGT Arg CTC Leu CCC Pro CAC His CGC Arg CTA Leu CCA Pro CAA Gln CGA Arg CTG Leu CCG Pro CAG Gln CGG Arg ATT Ile ACT Thr AAT Asn AGT Ser ATC Ile ACC Thr AAC Asn AGC Ser ATA Ile ACA Thr AAA Lys AGA Arg ATG Met ACG Thr AAG Lys AGG Arg GTT Val GCT Ala GAT Asp GGT Gly GTC Val GCC Ala GAC Asp GGC Gly GTA Val GCA Ala GAA Glu GGA Gly GTG Val GCG Ala GAG Glu GGG Gly TAA Och TGA Umb TAG Amb Three nonsense codons act as stop signals The Genetic Code

6 TTT Phe TCT Ser TAT Tyr TGT Cys TTC Phe TCC Ser TAC Tyr TGC Cys TTA Leu TCA Ser TAA Och TGA Umb TTG Leu TCG Ser TAG Amb TGG Trp CTT Leu CCT Pro CAT His CGT Arg CTC Leu CCC Pro CAC His CGC Arg CTA Leu CCA Pro CAA Gln CGA Arg CTG Leu CCG Pro CAG Gln CGG Arg ATT Ile ACT Thr AAT Asn AGT Ser ATC Ile ACC Thr AAC Asn AGC Ser ATA Ile ACA Thr AAA Lys AGA Arg ATG Met ACG Thr AAG Lys AGG Arg GTT Val GCT Ala GAT Asp GGT Gly GTC Val GCC Ala GAC Asp GGC Gly GTA Val GCA Ala GAA Glu GGA Gly GTG Val GCG Ala GAG Glu GGG Gly Some amino acids (e.g. leucine) have up to six codons The Genetic Code

7 TTT Phe TCT Ser TAT Tyr TGT Cys TTC Phe TCC Ser TAC Tyr TGC Cys TTA Leu TCA Ser TAA Och TGA Umb TTG Leu TCG Ser TAG Amb TGG Trp CTT Leu CCT Pro CAT His CGT Arg CTC Leu CCC Pro CAC His CGC Arg CTA Leu CCA Pro CAA Gln CGA Arg CTG Leu CCG Pro CAG Gln CGG Arg ATT Ile ACT Thr AAT Asn AGT Ser ATC Ile ACC Thr AAC Asn AGC Ser ATA Ile ACA Thr AAA Lys AGA Arg ATG Met ACG Thr AAG Lys AGG Arg GTT Val GCT Ala GAT Asp GGT Gly GTC Val GCC Ala GAC Asp GGC Gly GTA Val GCA Ala GAA Glu GGA Gly GTG Val GCG Ala GAG Glu GGG Gly Some amino acids (e.g. proline) have four codons The Genetic Code

8 TTT Phe TCT Ser TAT Tyr TGT Cys TTC Phe TCC Ser TAC Tyr TGC Cys TTA Leu TCA Ser TAA Och TGA Umb TTG Leu TCG Ser TAG Amb TGG Trp CTT Leu CCT Pro CAT His CGT Arg CTC Leu CCC Pro CAC His CGC Arg CTA Leu CCA Pro CAA Gln CGA Arg CTG Leu CCG Pro CAG Gln CGG Arg ATT Ile ACT Thr AAT Asn AGT Ser ATC Ile ACC Thr AAC Asn AGC Ser ATA Ile ACA Thr AAA Lys AGA Arg ATG Met ACG Thr AAG Lys AGG Arg GTT Val GCT Ala GAT Asp GGT Gly GTC Val GCC Ala GAC Asp GGC Gly GTA Val GCA Ala GAA Glu GGA Gly GTG Val GCG Ala GAG Glu GGG Gly Some amino acids (e.g. glutamine) have two codons The Genetic Code

9 TTT Phe TCT Ser TAT Tyr TGT Cys TTC Phe TCC Ser TAC Tyr TGC Cys TTA Leu TCA Ser TAA Och TGA Umb TTG Leu TCG Ser TAG Amb TGG Trp CTT Leu CCT Pro CAT His CGT Arg CTC Leu CCC Pro CAC His CGC Arg CTA Leu CCA Pro CAA Gln CGA Arg CTG Leu CCG Pro CAG Gln CGG Arg ATT Ile ACT Thr AAT Asn AGT Ser ATC Ile ACC Thr AAC Asn AGC Ser ATA Ile ACA Thr AAA Lys AGA Arg ATG Met ACG Thr AAG Lys AGG Arg GTT Val GCT Ala GAT Asp GGT Gly GTC Val GCC Ala GAC Asp GGC Gly GTA Val GCA Ala GAA Glu GGA Gly GTG Val GCG Ala GAG Glu GGG Gly Tryptophan and methionine have one codon each The Genetic Code

10 TTT Phe TCT Ser TAT Tyr TGT Cys TTC Phe TCC Ser TAC Tyr TGC Cys TTA Leu TCA Ser TAA Och TGA Umb TTG Leu TCG Ser TAG Amb TGG Trp CTT Leu CCT Pro CAT His CGT Arg CTC Leu CCC Pro CAC His CGC Arg CTA Leu CCA Pro CAA Gln CGA Arg CTG Leu CCG Pro CAG Gln CGG Arg ATT Ile ACT Thr AAT Asn AGT Ser ATC Ile ACC Thr AAC Asn AGC Ser ATA Ile ACA Thr AAA Lys AGA Arg ATG Met ACG Thr AAG Lys AGG Arg GTT Val GCT Ala GAT Asp GGT Gly GTC Val GCC Ala GAC Asp GGC Gly GTA Val GCA Ala GAA Glu GGA Gly GTG Val GCG Ala GAG Glu GGG Gly The last nucleotide in a codon is often irrelevant ACT Thr ACC Thr ACA Thr ACG Thr The Genetic Code

11 TTT Phe TCT Ser TAT Tyr TGT Cys TTC Phe TCC Ser TAC Tyr TGC Cys TTA Leu TCA Ser TAA Och TGA Umb TTG Leu TCG Ser TAG Amb TGG Trp CTT Leu CCT Pro CAT His CGT Arg CTC Leu CCC Pro CAC His CGC Arg CTA Leu CCA Pro CAA Gln CGA Arg CTG Leu CCG Pro CAG Gln CGG Arg ATT Ile ACT Thr AAT Asn AGT Ser ATC Ile ACC Thr AAC Asn AGC Ser ATA Ile ACA Thr AAA Lys AGA Arg ATG Met ACG Thr AAG Lys AGG Arg GTT Val GCT Ala GAT Asp GGT Gly GTC Val GCC Ala GAC Asp GGC Gly GTA Val GCA Ala GAA Glu GGA Gly GTG Val GCG Ala GAG Glu GGG Gly When the last nucleotide does matter, it is usually only important whether it is a purine or pyrimidine CAT His CAC His CAA Gln CAG Gln The Genetic Code

12 A nucleotide consists of a ribose sugar bonded to phosphoric acid, with a nitrogen base of either a pyrimidine (cytosine or thymine) or purine (adenine or guanine) as a side chain. A base called Uracil replaces all thymine bases in mRNA. The Genetic Code

13 TTT Phe TCT Ser TAT Tyr TGT Cys TTC Phe TCC Ser TAC Tyr TGC Cys TTA Leu TCA Ser TAA Och TGA Umb TTG Leu TCG Ser TAG Amb TGG Trp CTT Leu CCT Pro CAT His CGT Arg CTC Leu CCC Pro CAC His CGC Arg CTA Leu CCA Pro CAA Gln CGA Arg CTG Leu CCG Pro CAG Gln CGG Arg ATT Ile ACT Thr AAT Asn AGT Ser ATC Ile ACC Thr AAC Asn AGC Ser ATA Ile ACA Thr AAA Lys AGA Arg ATG Met ACG Thr AAG Lys AGG Arg GTT Val GCT Ala GAT Asp GGT Gly GTC Val GCC Ala GAC Asp GGC Gly GTA Val GCA Ala GAA Glu GGA Gly GTG Val GCG Ala GAG Glu GGG Gly With methionine and tryptophan, the exact base matters AT T Ile AT C Ile AT A Ile AT G Met The Genetic Code

14 Recommended supplementary reading Chatty, readable account of how Crick and Brenner solved the mystery of the genetic code. This is not a textbook. It is Francis Cricks autobiographical answer to James Watsons book The Double Helix, which describes the search for the structure of DNA, and in which Watson notes the dictionary definition of a crick as a pain in the neck. Crick, F. What Mad Pursuit? 1989 (James Cameron-Gifford Library Q143.C7, George Green Library QH506.CRI) The Genetic Code

15 How was the code deciphered? Most of the work to show the general form of the genetic code was done by Francis Crick and Sidney Brenner. Crick Brenner

16 They started off with George Gamows arguments based on simple school arithmetic to show that the code was probably a triplet code. Crick Brenner How was the code deciphered?

17 Why must the code be in triplets? There are only four nucleotides, therefore a singlet code (i.e. a code in which each nucleotide specifies an amino acid) could only encode four amino acids. However, there are twenty amino acids found in most proteins. Therefore, the code cannot be singlet in nature.

18 If the code were doublet, then there would be four possible nucleotides in the first position and four in the second. This gives : 4 4 = 4 2 = 16 codons Still too few to encode 20 amino acids. GATCGATC GATCGATCGATCGATCGATCGATCGATCGATC Why must the code be in triplets?

19 If the code were triplet, then there would be four possible nucleotides in the first position, four in the second and four in the third. This gives: = 4 3 = 64 permutations This is too many to encode 20 amino acids but the code could work if either some permutations are not used or if more than one encodes each amino acid (or both). Why must the code be in triplets?

20 Type of codeNumber of permutations Singlet4 1 = 4 Doublet4 2 = 16 Triplet4 3 = 64 Quadruplet4 4 = 256 Pentuplet 4 5 = 1024 Only the triplet code really looks feasible Why must the code be in triplets?

21 There are also different ways that the code can be read: It can be punctuated or unpunctuated. If it is unpunctuated it can be overlapping or non-overlapping. How was the code deciphered?

22 An overlapping code GTCACCCATGGAGGTATCT Once the first codon is set (e.g. GTC), the next one can only be one of four (TCA, TCG, TCT or TCC). This is a disadvantage.

23 A non-overlapping unpunctuated code GTCACCCATGGAGGTATCT There are three ways to read this type of code, referred to as reading frames. This makes this type of code non-ideal.

24 GTCACCCATGGAGGTATCT Here, one nucleotide (A) is used as a punctuation mark. This code has several advantages: 1. The reading frame is set by the punctuation. 2. Because only three nucleotides are used in codons, the number of coding permutations available is 3 3 = 27 amino acids A non-overlapping punctuated code

25 Is the code really overlapping? GTCACCCATGGAGGTATCT Once the first amino acid is set, the next one can only be one of four. Therefore, certain amino acids could never be next to each other. This can be tested by experimentation

26 Francis Crick and Sidney Brenner did nearest neighbour analysis on real proteins. They found that any amino acid could be next to any other one. Therefore, the code cannot be overlapping. Is the code really overlapping?

27 Is the code punctuated? Francis Crick and Sidney Brenner went on to analyse a particular type of mutant that is induced by intercalating agents (e.g. acridine dye). Intercalating agents will insert themselves between the base pairs of DNA. These can stretch the base pairs apart during replication and cause an extra nucleotide to be inserted or one to be left out.

28 They found a gene (the rII gene) that has special properties. It can tolerate several wrong codons in the early part of the coding sequence and still make an active protein as long as the later part of the coding sequence is correct. Is the code punctuated?

29 The mutations caused by intercalating agents fall into two classes, 1 and 2. Both cause a mutant phenotype in the rII gene. 1 2 Mutant phenotype Is the code punctuated?

30 Double mutants (two mutations in one gene) also cause a mutant phenotype in the rII gene Is the code punctuated? Mutant phenotype

31 When the double mutant has two different kinds of mutation, they suppress each other and you get a non-mutant phenotype in the rII gene. Wild type (non-mutant) phenotype 12

32 Remember that the mutations caused by acridine dyes result from the loss or gain of one nucleotide. They cause the reading frame to change and are called frame-shift mutations. The fact that they can arise means that there must be reading frames and that means that the code in unpunctuated.

33 How does this work? GTCACCCATGGAGGTATCT Original code GTCTACCCATGGAGGTATC Code with frame shift mutation All codons after the inserted nucleotide are wrong (some may be stop codons).

34 Two wrongs can make a right GTCACCCATGGAGGTATCT Original code GTCTACCATGGAGGTATCT Code with different frame shift mutations After second mutation, codons back in original frame.

35 Is the code triplet? Crick and Brenner went on to show that three frame shift mutations of the first type (insertion) or three of the second type (deletion) in the rII gene could also give a wild-type phenotype. This could only happen if the code was triplet. If the code was quadruplet then you would have to add or delete four nucleotides to reset the reading frame.

36 Three wrongs can make a right GTCACCCATGGAGGTATCT Original code GTCTACTCACATGGAGGTA Code with three similar frame shift mutations An extra codon is inserted and a few codons are wrong, then all of the rest are OK.

37 How was the code cracked? We must first consider how genetic information is used by the cell. In higher organisms (eukaryotes) the DNA is in the nucleus and the protein is made in the cytoplasm there must be an intermediate. Messenger RNA (mRNA) moves from the nucleus to the cytoplasm and carries the genetic code.

38 The Central Dogma Francis Crick proposed the idea that genetic information moves in one direction and called this the central dogma of molecular genetics. replication DNA RNA Protein transcriptiontranslation How was the code cracked?

39 Cells can be broken open and the elements needed for protein synthesis can be isolated. When RNA is added, the protein encoded by that RNA is made. Artificial RNA can be made in the test tube and added to this system. How was the code cracked?

40 Cells can be broken open and the elements needed for protein synthesis can be isolated. When RNA is added, the protein encoded by that RNA is made. bit/documents/codeoflife.htmlhttp://profiles.nlm.nih.gov/JJ/Views/Exhi bit/documents/codeoflife.html Artificial RNA can be made in the test tube and added to this system. This work was done by Marshall Nirenberg and Har Gobind Khorana Nirenberg Khorana How was the code cracked?

41 Nirenberg made simple RNA with the sequence: UUUUUUUUUUUUUUUUUUUUU When he put this into the test tube, he found that the protein made was a string of one type of amino acid, phenylalanine, joined together. Therefore the codon UUU (or TTT in DNA), encodes phenylalanine. How was the code cracked?

42 Similarly, RNA with the sequence: CCCCCCCCCCCCCCCCCCCCCC encodes a protein that is all proline. AAAAAAAAAAAAAAAAAAAA encodes a protein that is all lysine. How was the code cracked?

43 Khorana made less simple RNA with the sequence: UGUGUGUGUGUGUGUGUGUGU When he put this into the test tube, he found that the protein made was a string of two alternating amino acids, valine and cysteine. How was the code cracked? TGT = Cys GTG = Val

44 By successively more sophisticated experiments of this type, the amino acids specified by most of the 61 amino acid encoding triplets were identified. Final confirmation required experiments with another type of RNA, transfer RNA (tRNA), which is the subject of the next lecture. How was the code cracked?


Download ppt "The genetic code. Each amino acid is specified by a triplet of nucleotides, known as a codon. The Genetic Code."

Similar presentations


Ads by Google