1. Suppl. figure 1 Zale et al. 215E 223D 211E218E230E 36E 209F 23E 208F 236E212E213E 203D 210E 221D 207E WRI OLE DGA GAPDH 5E 100D 6B 25B 32D 206E205E 21E 204D 15D WRI OLE DGA GAPDH 216D 229E 3E 110D 222E 13A 21B 1E 32E 29D 19B 200E 3B 23C 5A 16C 38A12A 25C 28A26A WRI OLE DGA GAPDH 214D231D 220E225E 37E 227E 219D 36E 224E WRI OLE DGA GAPDH 27A WT 102 6A 32A 233 Suppl. Figure 1 Endpoint RT-PCR analyses of WRI1, OLE1, and DGAT 1-2 expression in trans genic sugarcane. WT: Wildtype plant. Sugarcan e GAPDH gene was used as an internal control.

2. 21.2 7.4 PWTW61E29D19B28C PWTW61E29D19B28C 21.2 7.4 (a) (b) 21.2 7.4 (c) PWTW61E29D19B28C (d) 10.0 6.0 WT1E29D19B5B28C Suppl. figure 2 Zale et al.

3. Suppl. Figure 2 Southern blot analyses of transgenic sugarcane lines. A DNA samples from t ransgenic sugarcane lines regenerated after bombardment with WRI1/nptII or co-bombarded with all plasmids and probed for WRI1. Genomic DNA was digested with EcoRI. The probe w as generated by PCR to the coding region of WRI1 using primers forward primer (TGCATCG ACTCCTCCACCATC) and reverse primer (TGATGATGCACCAGGTAGTTGC). Plasmid (P) is the 8.8 Kb linearized pJK403NPTII vector; WT= Wildtype sugarcane; Transgenic sugarcane l ines: W6, 1E, 29D19B, and 28C. W6 was bombarded with WRI1/nptII. All other lines were c o-bombarded with all plasmids. B) DNA samples from transgenic sugarcane lines regenerate d after co-bombardment with all plasmids and probed for OLE1. Plasmid (P) is the 8.7 Kb lin earized pJK304605 vector; WT= Wildtype sugarcane; Transgenic sugarcane lines: 1E to 28C. Genomic DNA was digested with HindIII. The probe was generated by PCR to the coding regi on of DGAT1-2 using forward primer (ACTGGCCGCTGCTGATGTGCTG) and reverse prime r (ACGCGCTCGATGGCGTTCAGG). C) DNA samples from transgenic sugarcane lines rege nerated after co-bombardment with all plasmids and probed for OLE1. Plasmid (P) is the 8.7 Kb linearized pJK304605 vector; WT= Wildtype sugarcane; Transgenic sugarcane lines co-bo mbarded with all plasmids 1E to 28C. Genomic DNA was digested with HindIII. The probe wa s generated by PCR to the coding region of OLE1 using primer forward primer (ACCCACCA CGACATCATCGG)and reverse primer (GTGCGGTCGCGGTCGTGCTC). D) DNA samples f rom transgenic sugarcane lines regenerated after co-bombardment with all plasmids and prob ed for PXA1/AGPase. WT= Wildtype sugarcane; 1E to 28C transgenic sugarcane lines. Geno mic DNA was digested with BamHI. The probe was generated by PCR to the BG intron using primer forward primer (ACTACCTACTCCAAAACAAAGC) and reverse primer (ATAGAGGAC ACTTTGGCGCG).

4. Suppl. figure 3 Zale et al. (a)

5. Suppl. Figure 3 (a) Fatty acid profile of TAG from wild-type and transgenic sugarcane immatur e leaves. (b) Fatty acid profile of TAG from wild-type and transgenic sugarcane immature stems. 25C and 233: Transgenic lines with co-expression of WRI1, DAGAT1-2 and OLE1 and co-suppr essing PXA1 and AGPase. WT: Wildtype plant. Error bar indicates standard error of the mean. Mean represents average of analysis from two independent progeny plants per line.