1. Replication Transcription Translation
DNA, RNA, and Protein
Replication
Transcription
Translation

2. Replication Occurs during S phase of cell cycle
DNA unwinds, in increments, via helicase
DNA polymerase makes 2 copies of DNA
Complementary base pairing: G=C; T=A
Leading strand has continuous replication
Lagging strand done in Okazaki fragments
Ligase joins segments on lagging strand

3. Making copies of DNA 5’TACCGACTTGATCATTTAGGTAGACATATT …3’
3’ATGGCTGAACTAGTAAATCCATCTGTATAA …5’
DNA splits into leading (5’) & lagging (3’) strands
Each strand does complementary base pairing.
and
3’ATGGCTGAACTAGTAAATCCATCTGTATAA…5’

4. Transcription Makes RNA copy of DNA via RNA polymerase
Makes mRNA, tRNA, or rRNA
RNA polymerase binds to DNA promoter
DNA strands unwind & separate
RNA polymerase adds free RNA nucleotides to complement 1 strand of DNA bases.
G =C; C=G; T=A; A=U
RNA polymerase releases DNA & new RNA when reaches a termination signal.

5. Transcription & Translation
DNA:5’TACCGACTTGATCATTTAGGTAGACAT…3’
mRNA:AUGGCUGAACUAGUAAAUCCAUCUGUA…
mRNA exits nucleus after processing cap & tail
mRNA on ribosome is translated via tRNAs.
tRNA anticodons pair with mRNA codons (UAA, UAG, UGA).
Each tRNA carries a specific amino acid or a stop signal.
Genetic code is maintained universally.
mRNA: AUGGCUGAACUAGUAAAUCCAUCUGUA
polypeptide: met-ala-glt-leu-val-ast-pro-ser-val-

6. Translation Involves all 3 types of RNA: mRNA, tRNA, rRNA
Produces polypeptides which form proteins
Peptide bonds link amino acids together
There are 20 essential amino acids found in all living things. Some have modifications.
Amino acids form 1o, 2o & 3oprotein structures
Structures are essential to protein function

7. Steps of Translation mRNA docks on ribosome. Its 1st codon is AUG
tRNA with met binds via its anticodon UAC.
tRNA with its amino binds to 2nd codon.
Ribosome detaches met from 1st tRNA.
Peptide bond forms between met & 2nd amino acid.
First tRNA exits the ribosome & 3rd tRNA enters.
Elongation continues until reaches stop codon
Ribosome separates from mRNA with last tRNA
Translation machinery then translates same or new mRNA

8. Human Genome The entire gene sequence of human DNA
3.2 billion base pairs in our 23 chromosomes
Use computers to analyze DNA sequences
Bioinformatics , a new field, compares these.
Help predict loci of genes
Don’t know yet what all 30,000 genes encode
Field of proteomics links gene to protein made