1. Genetic Diversity Biology/Env S 204 Spring 2009

2. Genetic diversity Heritable variation within and between populations of organisms Encoded in the sequence of 4 base- pairs that make up DNA Arises by mutations in genes and chromosomes

3. Genetic Diversity Very small fraction of genetic diversity is outwardly expressed Estimated 10 9 different genes across the Earth’s biota Represents a largely untapped genetic library

4. Genetic Diversity Genetic diversity is the foundation for all higher levels of biodiversity Genetic diversity provides the recipe for populations and species, which in turn form communities and ecosystems Genetic variation enables evolutionary change and artificial selection

5. Genetic Diversity Genetic diversity may have direct economic value (genes for disease resistance, biologically active compounds) But effective conservation for whatever purpose depends upon accurate, thoughtful assessment of genetic diversity Preservation of genetic diversity is usually a high priority in conservation programs

6. Nature of Genetic Diversity Information for all of life stored in the structure of DNA Genetic code or the units (bases, nucleotides) that make up DNA are essentially universal

7. Nature of Genetic Diversity A length of DNA (often with extra proteins) is a chromosome A section of DNA along the chromosome that contains the information to make a protein (or RNA) is a gene

8. chromosome gene Chromosome structure

9. DNA Structure ATTGCTGGACATATTGCTGGACAT TAACGACCTGTATAACGACCTGTA A = adenine T = thymine C = cytosine G = guanine Bases:

10. Nature of Genetic Diversity A gene may be several hundred to up to about two thousand units (bases) long A gene contains the information to make a protein or RNA A gene is a discrete unit of hereditary information

11. Nature of Genetic Diversity gene protein (enzymes, membranes, etc.) RNA (essential for production of proteins) gene

12. Nature of Genetic Diversity A given gene may have more than one form; the different forms of a single gene are called alleles. flower color gene with two alleles

13. Nature of Genetic Diversity flower color

14. Nature of Genetic Diversity Homozygous (both alleles in an individual are the same) Heterozygous (two different alleles present in an individual for one gene) or flower color gene

15. Nature of Genetic Diversity Prokaryotes vs. Eukaryotes bacteria, archaebacteria protists, fungi, plants, animals

16. Prokaryotes One-celled, no compartments (no nucleus) Genetic material in a single, circular chromosome Therefore only 1 copy of each gene per bacterium A typical bacterium has 1,000-2,000 genes

17. Eukaryotes One-celled or many-celled, with compartments (e.g., a nucleus is present) Genetic material in two to many linear, separate chromosomes in the nucleus Normally two copies of each gene present in an individual in part of the life cycle A eukaryote has about 50,000 genes on average

18. Origin of Genetic Diversity Mutation = change in the sequence of bases of DNA along a chromosome Change in a base or chunks of DNA can be rearranged Mutations can occur anywhere along a chromosome This is the ultimate source of all genetic variation

19. Measuring Genetic Diversity Chromosome = a collection of genes plus “extra” DNA in between that doesn’t code for anything Genes are used in measuring genetic diversity but The “extra” DNA is free to change and is also useful in assessing genetic diversity

20. Measuring Genetic Diversity Different parts of the DNA evolve at different rates—”extra” DNA changes faster than DNA in the genes Some genes evolve slowly and help in the study of deep branches of life (ancient lineages) “Extra” DNA can change so rapidly that every individual is distinct (except for clones)

21. Measuring Genetic Diversity Within an individual: % heterozygosity (alleles same or different in a given set of genes) Among individuals in a population: allele frequencies for given genes Between populations: % heterozygosity, allele frequencies, unique molecular markers

22. Measuring Genetic Diversity Measuring diversity between evolutionary lineages usually involves comparing sequences of DNA and looking for changes in bases or major rearrangments.

23. Measuring Genetic Diversity Loss of genetic diversity = loss of useful genetic diversity in the short term and reduction of evolutionary options in the long term.

24. Evolutionary Processes 1) Natural Selection 2) Gene Flow 3) Genetic Drift

25. Evolutionary Processes— 1) Natural Selection A major mechanism of evolution as proposed by Darwin A filter for genetic variation: the best adapted individuals survive and reproduce in greater numbers over time Not a directed process! Changes in direction and intensity depend on conditions and time span and available genetic diversity

26. Evolutionary Processes— 1) Natural Selection SURVIVOR http://science.discovery.com/interactives/literacy/darwin/darwin.html

27. Evolutionary Processes— 2) Gene Flow The exchange of genetic material within a population, between populations of a species, and even between species Gene flow among populations of a species maintains the integrity of the species Lack of gene flow can lead to speciation

28. Evolutionary Processes— 2) Gene Flow Population A Population B gene flow A B barrier arises Species A Species B reproductive isolation time

29. Evolutionary Processes— 2) Gene Flow Species A Species B gene flow allopatric speciation = geographic isolation + reproductive isolation

30. Evolutionary processes— 2) Gene Flow Species A (AA) X Species B (BB) Hybrid AB (infertile, cannot cross with either parent either)

31. Evolutionary processes— 2) Gene Flow Hybrid AB Chromosome doubling AABB (now sex cells can be produced!) AA X AABB AAB (infertile) sex cell A sex cell AB

32. Evolutionary Processes— 2) Gene Flow sympatric speciation = reproductive isolation of parent species from hybrid derivatives through hybridization and chromosome doubling without geographic isolation

33. Evolutionary Processes— 3) Genetic Drift Changes in the gene pool of a small population due to chance events Founder effect = one or two individuals disperse and start a new population with limited genetic diversity Bottleneck = extreme reduction in population size and therefore genetic diversity

34. Conservation Genetics Involves the use of genetic data and principles to guide conservation activities Genetics should be prominent in the practice of conservation

35. Conservation Genetics 1)Rate of evolutionary change in a population is proportional to the amount of genetic diversity available 2)Higher genetic diversity is usually positively related to fitness 3)Global pool of genetic diversity represents all of the information for all biological processes (= genetic library)

36. Conservation Genetics Small populations tend to lose genetic diversity over time!!!

37. Conservation Genetics Habitat fragmentation and destruction now produce and will continue to produce small, isolated populations Understanding the genetic status of species and populations and the consequences of small population sizes is vital to conservation, management, and recovery efforts.

38. Conservation Genetics A major goal is to preserve natural patterns of genetic diversity to the extent possible to preserve options for future evolutionary change. greater prairie chicken example

39. Conservation Genetics— Example: Prairie Chickens 35-year study of a remnant population of prairie chickens in Illinois In 1962, about 2,000 individuals present; in 1994, fewer than 50 Fertility and hatching rates declined significantly, as did genetic diversity Translocation program established in 1992 to bring in birds from MN, KS and NE

40. Conservation Genetics— Example: Prairie Chicken By 1994, increased survival of young prairie chickens was verified By 1997, there were significant increases in mean rates of fertility and hatching Once the main population in Illinois became isolated, it began to lose viability and without intervention, it most likely would have disappeared