1. Cancer and Genetics: What’s the Connection? Supported by a grant from Supported by a grant from the National Cancer Institute 1R25CA93426 1R25CA93426 Administered through the Administered through the Oncology Nursing Society Oncology Nursing Society

2. Part I DNA, Chromosomes, and Genes

3. Figure from the National Cancer Institute@ http://press2.nci.nih.gov/sciencebehind

5. Figure from the National Human Genome Research Institute (NIH) Loosely coiled DNA Tightly supercoiled DNA condensed and packed into a chromosome structure.

6. DNA: Deoxyribonucleic acid. The genetic material in a cell that contains genes. Most DNA is in the nucleus. Some DNA is extranuclear, present in other cell organelles such as the mitochondria. When the DNA represents all of the genes for the species, it is referred to as the “genome.”

7. DNA: DNA in humans is a linear, double- stranded structure composed of multiple units of four different nitrogenous bases, each attached to a sugar molecule. The bases in each strand are connected together by phosphate groups. The two individual strands are held together (loosely) by hydrogen bonds interacting between the base pairs of the strands. These double strands are divided into 46 separate chunks, one “chunk” for each chromosome.

8. Figure from the National Human Genome Research Institute (NIH)

9. Figure from the Roche Genetics Education Program Collection

10. Figure from the National Human Genome Research Institute (NIH)

11. Bases: Nucleoproteins created from amino acids as nitrogenous chemicals. Bases may be single ring structures (pyrimidines) or double-ringed structures (purines). These bases form the essential elements of nucleic acids.

12. Bases: A (adenine) G (guanine) Purines T (thymine) C (cytosine) Pyrimidines

13. NH O N NH 2 Cytosine: (Nitrogenous base - pyrimidine)

14. N N NH 2 Adenine: (Nitrogenous base - purine) NH N

15. G A C Adenine GuanineCytosine Thymine Purines Pyrimidines T

16. Nucleoside: A nitrogenous base of adenine, guanine, cytosine, or thymine attached to a five- sided sugar (pentose sugar).

17. The four bases of DNA converted to nucleosides by attaching a deoxyribose sugar (DR). T G A C DR

18. Nucleotide: A nucleoside (nitrogenous base attached to a five-sided sugar) connected to a phosphate group. It is these structures that assemble into a single strand of DNA.

19. The four nucleosides of DNA converted to nucleotides by attaching a phosphate groups (P). T G A C P P P P P P DR

20. Figure from the National Human Genome Research Institute (NIH)

21. Base Pairs: Nucleotides that pair up loosely together when DNA is double-stranded. They are held together with the relatively weak forces of hydrogen bonds. Normally, adenine and thymine form a pair by sharing 2 hydrogen bonds; cytosine and guanine form a base pair sharing 3 hydrogen bonds.

22. Two short DNA strand held loosely together by hydrogen bonds forming complementary base pairs. T G A C P P P P P P A-T complementary base pair G-C complementary base pair DR

23. Complementary Bases: The nitrogenous bases that normally pair using hydrogen bonds. Adenine and thymine are complementary to each other. Cytosine and guanine are complementary to each other. Because these pairs are complementary (and faithful), if the sequence of bases for one strand of DNA is known, the complementary strand can be predicted.

24. Loosely coiled helix of a section of DNA Figure from the Roche Genetics Education Program Collection

25. DNA: During the G 0 phase of the cell’s life, the two DNA strands are loosely coiled. This DNA structure is not visible with standard light microscopy. During cell division, DNA replicates itself & then compacts down into chromosome structures that can “split” in the mitosis phase of cell division, with each half of the chromosome going to the 2 different new daughter cells.

26. Figure from the National Human Genome Research Institute (NIH) Loosely coiled DNA Tightly supercoiled DNA condensed and packed into a chromosome structure.

27. Chromosome: A temporary but consistent state of cellular DNA tightly condensed & coiled into dense bodies that take up stain and are visible under standard light microscopy during metaphase of mitosis. Humans have 46 chromosomes divided into 23 pairs. This number is known as the "diploid" number of chromosomes for humans. These 46 chromosomes contain all the nuclear DNA of a human cell.

28. Chromosome

29. CentromereChromatid

30. “q arm” “p arm”

31. Telomeres With every cell division, telomeres are shortened by about 100 bases. When telomeres are gone, cell death (apoptosis) ensues. The enzyme, telomerase, extends the life of the telomere. Many cancer cells have a lot of telomerase and their telomeres do not shorten with cell division, contributing to their “immortality.” 3,000 – 20,0000 bases

32. These are the extreme ends or “tips” of a chromosome. Within these structures are multiple repeat sequences. As a person ages, the telomeric areas become shorter. These play a role in cancer development in that many cancer cells retain their telomeric lengths and have minimal limits placed on their reproductive capacity. The enzyme responsible for maintaining the telomeres is telomerase. Telomeres:

33. A set of stained metaphase chromosomes exactly as how they appear for chromosomal analysis under the microscope.

34. Karyotype: An organized arrangement of all of the metaphase chromosomes within one cell. The chromosomes are first collected into pairs and then lined up according to size (largest first) and centromere position. This gross representation of DNA can be used to determine missing or extra whole chromosomes and some large structural rearrangements.

35. Metaphase chromosomes from one cell arranged in a “karyotype” from largest to smallest and most metacentric to least metacentric.

36. Karyotype: Because many chromosomes are of the same approximate size and shape, it can be difficult to differentiate specific chromosome pairs. A modification technique is to use an enzyme that selectively strips some of the surrounding proteins away from the chromosomes, allowing a “banding” pattern to be seen after staining. The “bands” or stripes are unique to each chromosome pair and increase the accuracy of individual chromosome identification.

39. Karyotype: When a karyotype shows the normal number of chromosomes for human cells, the chromosome number is said to be euploid. If the karyotype shows more or less than the normal number, or has discernable structural abnormalities, it is said to be aneuploid. Most cancer cells express some degree of chromosome aneuploidy.

40. An aneuploid tumor karyotype of a Wilm’s tumor showing multiple abnormalities of chromosome number and/or structure

41. Autosomes: The 22 pairs of human chromosomes that do not code for the sexual differentiation of the individual. These chromosomes contain the genes that code for all the structures and regulatory proteins needed for normal function. Sex Chromosomes: The pair of chromosomes that contain the genes that code for the sexual differentiation of the individual. In males, the sex chromosomes are an X and a Y. In females, the sex chromosomes are two XXs.

42. All chromosomes underlined in red constitute the “autosomes.” The chromosomes circles in green are the sex chromosomes.

43. Karyotype Exercise http://www.biology.arizona.edu/human_bio /activities/karyotyping/karyotyping.html

46. Chromosome Function: Chromosomes are actually large “chunks” of DNA that has been replicated during DNA synthesis. The structure of a chromosome, with 2 chromatids, allows the replicated DNA to be “pulled apart” during cell division so that each new daughter cell inherits exactly the right amount of DNA. So, a major purpose of packing DNA into the shapes of the 46 chromosomes is to ensure precise delivery of DNA to the next cell generation.

47. Gene: A gene is a specific segment(s) of DNA that contains the genetic code for a specific protein. For every human trait or physical characteristic, there is a pair of gene alleles, one on each of the pair of chromosomes that have the locus for that trait. For example, we each have 2 specific gene alleles for blood type. One of these alleles is on one chromosome 9 of the pair, the other allele is located on the other number 9 chromosome. One allele was inherited from our mothers and the other allele was inherited from our fathers.

48. Gene Function: The purpose of a gene is to code for the making of a specific protein used by a cell, tissue, or organ within the individual. For example, the hormone insulin is a protein. When a person’s blood glucose level starts to rise, the beta cells of the pancreas rapidly make insulin to meet the immediate needs of the person for blood glucose homeostasis.

49. AlaPheValLysSerLeuGly Primary Protein Structure Gene sequence for this seven amino acid protein = CGAAAGCATTCGTTCAATCCT

50. Gene Locus: The place on a chromosome pair where a specific gene resides. For most traits, the gene locus is the same for all humans.

51. Allele: One of possible alternate forms of a gene for any trait or protein controlled by a single gene. For blood type, there are 3 possible gene alleles, A, B, and O. Each person, however, only has two of these possible 3 alleles that determine blood type. Some traits have even more than 3 possible gene alleles types, but each person only has 2.

52. Father’s Chromosome Pair Mother’s Chromosome Pair Gene locus For trait 1

53. 1a Father’s Chromosome Pair Mother’s Chromosome Pair Gene locus For trait 1 1b1c1d The individual colors for trait 1 indicate 4 different alleles are possible for ear shape. However, any person can only have 2 alleles for any one single gene trait.

54. 1a1c Four possible allelic combinations for trait 1 among offspring of parents from previous slide 1a1d1b1b1c1d

55. Allele: If a person has two identical alleles for a single gene trait, the person is said to be homozygous for that trait. So, if a person has an “A” blood type gene allele on one number 9 chromosome, and an “A” blood type gene allele on the other number 9 chromosome, the person is homozygous for that trait and will express the A blood type.

56. Allele: If a person has two different alleles for a single gene trait, the person is heterozygous for that trait. So, if a person has an “A” blood type gene allele on one number 9 chromosome, and a “B” blood type gene allele on the other number 9 chromosome, he or she is heterozygous for that trait and will express the AB blood type. Because the A and B alleles are equally dominant ( co-dominant ), they will both be expressed in the actual blood type.

57. Allele: There are differences in expression of the alleles for a trait depending on whether an allele is dominant or is recessive. If a person has an “A” blood type gene allele on one number 9 chromosome, and an “O” blood type gene allele on the other number 9 chromosome, he or she is heterozygous for that trait and express only the A blood type. Because the A allele is dominant and the O allele is recessive, he or she will not both be expressed in the actual blood type. Only the dominant allele is expressed and the recessive allele is “silent.”

58. Genotype: The actual gene constitution of a given person. For example, if a person has type O blood, the genotype for blood grouping would be the same as the phenotype (“O”) because type O blood is a recessive trait and requires that both alleles be the “O” gene to be expressed. The widow’s peak, however, is a dominant trait and will be expressed even if the person has only one allele for widow’s peak.

59. Phenotype: The observable characteristics of a given person. For example, a person may have the blood type of “O,” and have a widow’s peak hairline. The phenotype does not always tell you what the genotype of the person is.

60. Gene Expression: Activation of a gene leading to transcription, translation, and synthesis of a specific protein. This process results in the making of a protein to ensure the observable presence of the trait or condition coded for by the gene.

61. Gene Suppression: Suppression of the expression of specific gene activity through the action of a regulatory gene. The outcome of gene expression can be inhibited indirectly through signal transduction pathways that operate at the cell level rather than at the gene level. For example, the Tp53 gene prevents complete expression of an oncogene by inhibiting mitosis rather than by turning off oncogene expression.