1. Recombinant DNA prepare foreign (target) DNA prepare vector (host)
recombine target and vector DNA
introduce rDNA to host
screen for DNA of interest
gDNA (fragments)
cDNA (copy of RNA)
Preparing gDNA
restriction enzymes
‘random nuclease’
 size fractionate

2. gDNA vs cDNA level of expression introns ease of preparation
differential gene expression
accessibility
introns
complicates gDNA analysis
can preclude expression
ease of preparation
cDNA more work

3. Preparation of cDNA 1) Isolate mRNA 2) Synthesize DNA-RNA hybrid
reverse transcriptase
oligo-dT primer
random priming
3) Synthesize 2nd DNA strand
4) Add termini
 RNA dependent DNA polymerase

4. 1) Isolate mRNA
2) Synthesize DNA-RNA hybrid
3) Synthesize 2nd DNA strand
self-priming
replacement synthesis
primed synthesis
4) Add termini

5. 1) Isolate mRNA
2) Synthesize DNA-RNA hybrid
3) Synthesize 2nd DNA strand
4) Add termini
i.e., linkers
CGGAATTCCG
GCCTTAAGGC
Eco RI

6. Recombinant DNA Vectors
autonomously-replicating DNA used to ‘carry’ and amplify foreign DNA within host cell
eg: plasmids, phage/viruses, or combinations
Plasmids
extra-chromosomal elements
1-200 kb size range
transmitted during conjugation
antibiotic resistance
low copy number vs high copy number

7. Useful Plasmid Features
Relaxed Replication
Selectable Markers
Streamlined
Polylinker or MCS
Identification of Recombinants
most derived from pUC or pBR322
|SacI| |ScII| |XbaI||SpeI||BamH||SmaI||PstI||EcRI||EcRV||HIII||ClaI| |SalI||XhoI| |KpnI|
GAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACC
CTCGAGGTGGCGCCACCGCCGGCGAGATCTTGATCACCTAGGGGGCCCGACGTCCTTAAGCTATAGTTCGAATAGCTATGGCAGCTGGAGCTCCCCCCCGGGCCATGG
Multiple Cloning Site:

8. Generic rDNA Protocol prepare foreign DNA prepare vector
ligate foreign DNA and vector
introduce vector into host
screen for rDNA of interest

9. Ligation Reaction mix foreign and vector DNA in presence of DNA ligase
optimal ratios of vector to insert generally 1.5-2:1
intermolecular base-pairing can occur between compatible overhangs

10. DNA Ligase
catalyzes the formation of phosphodiester bond between 5’-PO4 and 3’-OH
i.e., joins DNA fragments
typically carried out at lower temperatures (8-16o) for extended periods

11. Intramolecular vs. Intermolecular

12. Removal of 5’-PO4 Prevents Vector Self Ligation

14. prepare foreign DNA
prepare vector
ligate target and vector
introduce rDNA to host
heat shock + Ca2+
electroporation
select for transformants with antibiotic
screen for rDNA of interest

15. Colony Lift Sources of Probes cloned genes synthetic oligonucleotides
PCR products

16. Identifying Recombinants
based on interruption of a gene
eg., lacZ gene = b-galactosidase
intact b-galactosidase produces blue color in presence of X-gal
-complementation or blue-white screening