Presentation is loading. Please wait.

Presentation is loading. Please wait.

Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA.

Similar presentations


Presentation on theme: "Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA."— Presentation transcript:

1 prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA (fragments) cDNA (copy of RNA) Preparing gDNA restriction enzymes random nuclease size fractionate

2 gDNA vs cDNA level of expression differential gene expression accessibility introns complicates gDNA analysis can preclude expression ease of preparation cDNA more work

3 Preparation of cDNA 1)Isolate mRNA 2)Synthesize DNA-RNA hybrid reverse transcriptase oligo-dT primer random priming 3)Synthesize 2 nd DNA strand 4)Add termini RNA dependent DNA polymerase

4 1)Isolate mRNA 2)Synthesize DNA-RNA hybrid 3)Synthesize 2 nd DNA strand self-priming replacement synthesis primed synthesis 4)Add termini

5 1)Isolate mRNA 2)Synthesize DNA-RNA hybrid 3)Synthesize 2 nd DNA strand 4)Add termini i.e., linkers CGGAATTCCG GCCTTAAGGC Eco RI

6 Recombinant DNA Vectors Plasmids extra-chromosomal elements 1-200 kb size range transmitted during conjugation antibiotic resistance low copy number vs high copy number autonomously-replicating DNA used to carry and amplify foreign DNA within host cell eg: plasmids, phage/viruses, or combinations

7 Useful Plasmid Features Relaxed Replication Selectable Markers Streamlined Polylinker or MCS Identification of Recombinants most derived from pUC or pBR322 |SacI| |ScII| |XbaI||SpeI||BamH||SmaI||PstI||EcRI||EcRV||HIII||ClaI| |SalI||XhoI| |KpnI| GAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACC CTCGAGGTGGCGCCACCGCCGGCGAGATCTTGATCACCTAGGGGGCCCGACGTCCTTAAGCTATAGTTCGAATAGCTATGGCAGCTGGAGCTCCCCCCCGGGCCATGG Multiple Cloning Site:

8 prepare foreign DNA prepare vector ligate foreign DNA and vector introduce vector into host screen for rDNA of interest Generic rDNA Protocol

9 mix foreign and vector DNA in presence of DNA ligase optimal ratios of vector to insert generally 1.5-2:1 intermolecular base-pairing can occur between compatible overhangs Ligation Reaction

10 catalyzes the formation of phosphodiester bond between 5-PO 4 and 3-OH i.e., joins DNA fragments typically carried out at lower temperatures (8-16 o ) for extended periods DNA Ligase

11 Intramolecular vs. Intermolecular

12 Removal of 5-PO 4 Prevents Vector Self Ligation

13

14 prepare foreign DNA prepare vector ligate target and vector introduce rDNA to host heat shock + Ca 2+ electroporation select for transformants with antibiotic screen for rDNA of interest

15 Colony Lift Sources of Probes cloned genes synthetic oligonucleotides PCR products

16 Identifying Recombinants based on interruption of a gene eg., lacZ gene = -galactosidase intact -galactosidase produces blue color in presence of X-gal -complementation or blue- white screening


Download ppt "Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA."

Similar presentations


Ads by Google