Presentation is loading. Please wait.

Presentation is loading. Please wait.

Proteins in the Body DNA is found in almost all living organisms and directs protein synthesis Examples of protein are: Enzymes (ex. lactase) Hormones.

Published byTheodora Barnett Modified over 8 years ago

Similar presentations

Presentation on theme: "Proteins in the Body DNA is found in almost all living organisms and directs protein synthesis Examples of protein are: Enzymes (ex. lactase) Hormones."— Presentation transcript:

1

2 Proteins in the Body DNA is found in almost all living organisms and directs protein synthesis Examples of protein are: Enzymes (ex. lactase) Hormones (ex. insulin) Antibodies Hemoglobin Cell membranes Receptor molecules

3 What are proteins made of? Made up of 20 different amino acids Different combinations of amino acids = different protein produced The amino acids formed are determined by the base sequence in our DNA One gene = one protein Protein Synthesis relies on 3 types of RNA –rRNA –mRNA –tRNA

4 DNA vs. mRNA Location: nucleus and cytoplasm Strand number: Single stranded Sugar: ribose Nitrogen Bases: 4 bases –C, G, A, Uracil Location: nucleus (and cytoplasm during cell division) Strand number: Double stranded Sugar: deoxyribose Nitrogen Bases: 4 bases –C, G, A, Thymine

5 Nucleic Acids

6 Draw DNADraw mRNA A T C G T A G C Coding Strand U A G C

7

8 Types of RNA Messenger RNA (mRNA) –Involved in transcription (1 st stage of protein synthesis) –“Photocopies” the DNA and carries message from DNA in nucleus to ribosome in cytoplasm Ribosomal RNA (rRNA) –Makes up the ribosomes Transfer RNA (tRNA) –carries amino acids to mRNA All RNA produced in nucleolus. tRNA & rRNA - In cytoplasm only mRNA in cytoplasm & nucleus

9 Protein Synthesis Protein Synthesis Occurs primarily in ribosomes Instructions for protein contained in DNA (cookbook) Message must get from nucleus to cytoplasm (DNA to ribosome) Process occurs in 2 steps: 1. Transcription2. Translation In nucleus In cytoplasm

10 Protein Synthesis Protein Synthesis In nucleus In cytoplasm

11 Step1: Transcription Occurs in the nucleus mRNA (photocopy) made using DNA as a template, because DNA is too large to exit the nucleus If the DNA base sequence is A A T T C C G G A (these are called DNA triplets) The mRNA molecule manufactured would be U U A A G G C C U (these are called codons ) Each DNA triplet has a complementary codon (on the mRNA) mRNA exits nucleus Code must be transcribed then translated

12 Transcription DNA used as template to build mRNA

13

14 Practice: DNA Strand: A T G G T C T C G mRNA Strand: How many triplets or codons are there? 3

15 Codons Each codon codes for an amino acid May code for start = initiator codon (starts protein synthesis) May code for stop = terminator codon (stops protein synthesis) AUG is an initiator codon but also codes for the amino acid methionine If code AUG is in middle it must code for methionine Data table of mRNA codons is supplied in diploma!!

16 Code must be transcribed then translated From the mRNA codon table, determine the amino acid

17 DON’T CONFUSE WITH DNA SEQUENCE!!

18 TAC CCG GCA TCG ATA GCA ATC DNA coding strand AUGGGCCGU DNA non-coding mRNA Amino acids AGCAUCGUUAG ATGGGCCGTAGCTATCGTTAG start glyargsertyrargstop U

19 I wish I was adenine then I could pair with U

20 Translation Occurs in the cytoplasm mRNA arrives at a ribosome This is where amino acids are assembled with the help of tRNA molecules tRNA brings the correct amino acid to the ribosome based on complimentary base pair rules –Ex. A attracts U Since there are 20 amino acids, there are 20 different tRNAs

21 Translation mRNA U U A A G G C C U 3 anticodons 3 codons tRNA A A U Amino acids leucine tRNA brings the correct amino acid to the ribosome when its anticodon matches the mRNA codon. U C CG G A - arginine - proline

22 Translation: mRNA from the nucleus associates with a ribosome. Ribosomes are made up of rRNA and other proteins The ribosome acts like a scaffold, holding the mRNA in position while the protein is being built

23 Translation Step 1 1. tRNA picks up amino acid and joins with mRNA

24 Translation 2. The ribosome moves down the mRNA and another tRNA brings the next amino acid. Adjacent amino acids are held together by peptide bonds.

25 Translation Step 4 3. When mRNA codon reads “stop” (either UAG, UAA, or UGA), the polypeptide (amino acid chain) is released. It then goes to the golgi complex.

26 The golgi complex will package the protein to be used for different functions throughout the body. Occurs in the Ribosome Occurs in the Golgi apparatus http://www.youtube.com/watch?v=2Jgb_DpaQhM&safety_mode=true&safe=active Bozeman proteins 9:16 Protein synthesis overview http://www.wiley.com/college/boyer/0470003790/animations/translation/translation.htm

27 Translation Requires many Ribosomes

28 Protein Synthesis: Transcription and Translation Cell membrane Nucleus TRANSCRIPTION mRNA aa TRANSLATION DNA ribosome codon tRNA Amino acid anticodon peptide bond To Golgi apparatus to be folded/coiled and packaged Amino acid chain or polypeptide triplet

29 mRNA copies the code from DNA and carries it to the ribosome. tRNA brings the amino acids to mRNA to form an amino acid chain.

30 Protein Synthesis Transcription - Location: nucleus - DNA (a gene) is used to code for mRNA -One gene = one protein - “T” is replaced with “U” Translation -Location: cytoplasm and ribosomes -mRNA is read -tRNA transfers amino acids -amino acids are linked by peptide bonds DNA replication, transcription and translation video 3-D: http://www.youtube.com/watch?v=4PKjF7OumYo&safety_mode=true&persist_safety_mode=1 http://bcs.whfreeman.com/thelifewire/content/chp12/1202003.html Animation

31 Video: Protein Synthesis on youtube http://www.youtube.com/watch?v=NJxobgkPEAo&safety_mode =true&safe=active&persist_safety_mode=1

32 1CDNA strand 1 (non-coding) 2AGGDNA strand 2 (coding) 3CAUmRNA codons 4UGGtRNA anticodons 5amino acids Can you go back and forth? Given an mRNA codon, you should be able to determine the nucleotide sequence on the DNA coding strand, tRNA anticodons and the amino acids!

33 1CCAACCTCCDNA strand 1 (anti-sense) 2GGTTGGAGGDNA strand 2 (sense) 3CCAACCUCCmRNA codons 4GGUUGGAGGtRNA anticodons 5amino acids PROLINE SERINETHREONINE Can you go back and forth? Given an mRNA codon, you should be able to determine the nucleotide sequence on the DNA coding strand, tRNA anticodons and the amino acids!

34 Review Questions What is the mRNA codon for the DNA triplet AAT = What is the DNA triplet for the mRNA codon CCG = What is the tRNA anticodon for the DNA triplet GCA = What is the mRNA codon for the tRNA GAU = What is the tRNA anticodon for the mRNA codon UUA = What is the DNA triplet for the anticodon CUA = What is the codon for the anticodon UAG = What is the anticodon for the DNA triplet CTA = UUA GGC =GCA CUA AAU =CTA AUC =CUA CGU mRNAtRNA mRNADNA mRNAtRNA GAU http://learn.genetics.utah.edu/content/molecules/transcribe/ Make your own protein!

35 Transcription http://www.youtube.com/watch?v=D5vH4Q_t AkY&feature=relatedhttp://www.youtube.com/watch?v=D5vH4Q_t AkY&feature=related http://www.youtube.com/watch?v=4PKjF7Ou mYohttp://www.youtube.com/watch?v=4PKjF7Ou mYo Great Review Videos

36 Do now: Work on pg 43-44

37 Taboo List A mRNA Polymerase Traslation Amino acid phosphate List B Guanine DNA Helicase Trascription tRNA

Download ppt "Proteins in the Body DNA is found in almost all living organisms and directs protein synthesis Examples of protein are: Enzymes (ex. lactase) Hormones."

Similar presentations

Bellringer- Write down 3 interesting things about DNA that you didn’t know before. On page 15. You should have learned at least 3 things.

Bellringer- Write down 3 interesting things about DNA that you didn’t know before. On page 15. You should have learned at least 3 things.
Unit 4 Part I Transcription.

Unit 4 Part I Transcription.
The Three T’s 1. Transcription 2. Translation 3. Termination

The Three T’s 1. Transcription 2. Translation 3. Termination
8.4 DNA Transcription 8.5 Translation

8.4 DNA Transcription 8.5 Translation
The Structure of RNA RiboNucleic Acid

The Structure of RNA RiboNucleic Acid
RNA and Protein Synthesis. DNA to RNA to Protein Focus Questions: –How does the message coded in the base sequence of DNA eventually create a protein?

RNA and Protein Synthesis. DNA to RNA to Protein Focus Questions: –How does the message coded in the base sequence of DNA eventually create a protein?
DNA AND PROTEIN SYNTHESIS 2008. DNA (DEOXYRIBONUCLEIC ACID) Nucleic acid that composes chromosomes and carries genetic information.

DNA AND PROTEIN SYNTHESIS DNA (DEOXYRIBONUCLEIC ACID) Nucleic acid that composes chromosomes and carries genetic information.
Chapter 11 DNA and Genes. Proteins Form structures and control chemical reactions in cells. Polymers of amino acids. Coded for by specific sequences of.

Chapter 11 DNA and Genes. Proteins Form structures and control chemical reactions in cells. Polymers of amino acids. Coded for by specific sequences of.
1. RNA vs. DNA RNADNA TThe sugar is RIBOSE UURACIL (U) is substituted for (T) Thymine AA=U CC=G RRNA is a single stranded chain of nucleotides.

1. RNA vs. DNA RNADNA TThe sugar is RIBOSE UURACIL (U) is substituted for (T) Thymine AA=U CC=G RRNA is a single stranded chain of nucleotides.
Protein Synthesis Pages 336-341 Part 3. Warm-Up: DNA 101 1.DNA is a double stranded sequence of ___________ (smallest unit of DNA). 2.Short segments of.

Protein Synthesis Pages Part 3. Warm-Up: DNA DNA is a double stranded sequence of ___________ (smallest unit of DNA). 2.Short segments of.
Do Now: Do Now: 1. What structure makes proteins? 2. Where are these found? 3. Where is DNA stored? 4. Why not in cytoplasm? Homework: read 12-3 and complete.

Do Now: Do Now: 1. What structure makes proteins? 2. Where are these found? 3. Where is DNA stored? 4. Why not in cytoplasm? Homework: read 12-3 and complete.
Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.
RNA & Protein Synthesis

RNA & Protein Synthesis
RNA & Protein Synthesis.

RNA & Protein Synthesis.
RNA and protein synthesis. RNA Single strand of nucleotides Sugar is ribose Uracil instead of thymine.

RNA and protein synthesis. RNA Single strand of nucleotides Sugar is ribose Uracil instead of thymine.
DNA and RNA Objectives: 8.0 Identify the structure and function of DNA, RNA, and protein. 8.1 Explaining relationships among DNA, genes, and chromosomes.

DNA and RNA Objectives: 8.0 Identify the structure and function of DNA, RNA, and protein. 8.1 Explaining relationships among DNA, genes, and chromosomes.
11-18-08. DNA Review  Contains the genetic instructions used in the development and functioning of all organisms  Found in the nucleus of cells!  Made.

DNA Review  Contains the genetic instructions used in the development and functioning of all organisms  Found in the nucleus of cells!  Made.
RNA and Protein Synthesis. Write these terms in your journal Ribosome — makes proteins Ribosome — makes proteins RNA polymerase — enzyme that puts together.

RNA and Protein Synthesis. Write these terms in your journal Ribosome — makes proteins Ribosome — makes proteins RNA polymerase — enzyme that puts together.
RNA and Protein Synthesis

RNA and Protein Synthesis
Protein Synthesis The majority of genes are expressed as the proteins they encode. The process occurs in 2 steps: 1. Transcription (DNA---> RNA) 2. Translation.

Protein Synthesis The majority of genes are expressed as the proteins they encode. The process occurs in 2 steps: 1. Transcription (DNA---> RNA) 2. Translation.

Similar presentations

Ads by Google