Presentation is loading. Please wait.

Presentation is loading. Please wait.

WSSP Chapter 7 BLASTN: DNA vs DNA searches atttaccgtg ttggattgaa attatcttgc atgagccagc tgatgagtat gatacagttt tccgtattaa taacgaacgg ccggaaatag gatcccgatc.

Published byEdwina Rodgers Modified over 8 years ago

Similar presentations

Presentation on theme: "WSSP Chapter 7 BLASTN: DNA vs DNA searches atttaccgtg ttggattgaa attatcttgc atgagccagc tgatgagtat gatacagttt tccgtattaa taacgaacgg ccggaaatag gatcccgatc."— Presentation transcript:

1 WSSP Chapter 7 BLASTN: DNA vs DNA searches atttaccgtg ttggattgaa attatcttgc atgagccagc tgatgagtat gatacagttt tccgtattaa taacgaacgg ccggaaatag gatcccgatc atgattgctt caatattttc acttcaatga ttggttctaa gcattcgaat gcgtacccgt ttgattaata tttccatttc tgtcccagtt tttaattttc atttcttttg gttaaaaaat tcccagtctc ttgaatgctt ttctaaaatc tttaattcaa ttatttatta gaatcttctg ttttgagaac tttgtaatgt aattaaataa tttgatgaaa tgattatgaa tgcgaataaa ttattaattt accgtgctga ttggattgaa attatcttgc atgagccagc tgatgagtat gatacagttt tccgtattaa taacgaacgg ccggaaatag gatcccgatc atgattgctt caatattttc acttcaatga ttggttctaa gcattcgaat gcgtacccgt ttgattaata tttccatttc tgtcccagtt tttaattttc atttcttttg gttaaaaaat tcccagtctc ttgaatgctt ttctaaaatc tttaattcaa ttatttatta gaatcttctg ttttgagaac tttgtaatgt aattaaataa tttgatgaaa tgattatgaa tgcgaataaa ttattaattt accgtgttgg attgaaggta attatcttgc atgagccagc tgatgagtat gatacagttt

2 © 2014 WSSP

3 DSAP: BLASTn Page p. 7-1 © 2014 WSSP

4 p. 7-1 NCBI BLAST Home Page © 2014 WSSP

5 p. 7-2 NCBI BLASTN search page © 2013 WSSP

6 p. 7-2 Copy sequence from DSAP or wave form program © 2014 WSSP

7 p. 7-3 Choose a database (nr/nt or est) © 2014 WSSP

8 p. 7-4 Search options (Use defaults) © 2014 WSSP

9 p. 7-5 BLASTN progress report (search may take a few minutes) © 2014 WSSP

10 p. 7-5 Format options (use defaults) © 2014 WSSP

11 p. 7-6 EX1.14 BLASTN nr/nt database © 2014 WSSP

12 Graphic report of EX2.09 p. 7-7 © 2014 WSSP

13 p. 7-7 BLASTN list of matches for EX1.14 © 2014 WSSP

14 EX2.09 BLASTN p. 7-9 © 2014 WSSP

15 Clicker Question: Which match is the most meaningful? A) B) C) D) E) None © 2014 WSSP

16 Clicker Question: Which part of the gene appears to be the most conserved? A) Bp 1-100 B) Bp 100-300 C) Bp 300-500 D) All E) None © 2014 WSSP

17 Clicker Question: The entire insert of a clone was sequenced and a BLASTN search was performed. Are these matches likely to be significant? A) Yes B) No C) Can not tell from data © 2014 WSSP

18 Question: Which of the following E values indicates the best match? A)1e-10 B)5e-91 C)5.3 D)0.0 E)Can not tell from this data © 2014 WSSP

19 Best match to EX1.14 p. 7-9 Our Seq. Database Seq. Length of sequence Mismatch Match © 2014 WSSP

20 Perfect, but short, matches are not usually meaningful >gi|14250883|emb|AL583809.3|CNS07EFY Human chromosome 14 DNA sequence BAC R-736L22 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Query: 189 ttttctgaatattcataata 208 |||||||||||||||||||| Sbjct: 60645 ttttctgaatattcataata 60626 7-11 © 2014 WSSP

21 Examine the best alignments: Are they significant? 7-9 © 2014 WSSP

22 Mismatches i)Bad sequence on our part ii)Bad sequence on their part iii)Differences in the sequence of the two organisms C R E L L I L D A Query TGT CGT GAA CTC CTA ATT CTC GAC GCC ||| ||| ||| || || || || || || Sbjct TGT CGT GAA CTT CTG ATC CTT GAT GCA C R E L L I L D A Query: 383 AGCGTTGCCGTTCGTCAGCTTGATGTTAAGCTGGGCAGCGCGCTCGACGATTCCTTTGCG 324 |||||| |||||||||||||||||||| | ||| || ||||||||||||||||| ||||| Sbjct: 6152 AGCGTTTCCGTTCGTCAGCTTGATGTTCAACTGAGCGGCGCGCTCGACGATTCCCTTGCG 6211 Wobble position: same amino acid, but different codon….degenerate code © 2014 WSSP

23 C R R T P D P * Query TGTCGT-CGAACTCCTGATCCTTGA |||||| |||||||||||||||||| Sbjct TGTCGTCCGAACTCCTGATCCTTGA C R E L L I L D p. 7-13 Small Gaps- alter the reading frame of the protein © 2014 WSSP

24 Query: 179 TTCGAGCTACCAGATGATC-GATTGGAACAT-T-C--TGTCATTG-AC-CTTC-AGGTAA 230 ||||||| || | | || |||| || || | | | | ||| | |||| |||| | Sbjct: 4684 TTCGAGCG-CC-GTTAATATGATTACAATATCTACAATATTATTATATGCTTCCAGGTGA 4741 Query: 231 TCAACCATGACCGTGTCAACCGAAACGACGTTATCGGCCGTGCACTATTGAACATGGAGG 290 |||| ||||||||||| ||||| || || || || |||||||| || | || ||||| | Sbjct: 4742 TCAATCATGACCGTGTTAACCGTAATGATGTAATTGGCCGTGCCCTTCTTAATATGGAAG 4801 An example of a match with and without gaps. p. 7-13 © 2014 WSSP

25 >gi|241990611|dbj|AK330768.1| Triticum aestivum cDNA, clone: SET5_E05, cultivar: Chinese Spring Length=650gi|241990611|dbj|AK330768.1| Score = 219 bits (242), Expect = 2e-53 Identities = 211/271 (77%), Gaps = 0/271 (0%) Query 10 GATGTTGGAAGGGAGGGCGAGAGTAGAAGACACCGACATGCCGAGGAAGATGCAGGCGGA 69 |||| ||||||||| ||||| || || ||||||||||||||| ||||||||| | | Sbjct 78 GATGCTGGAAGGGAAGGCGACGGTGGAGGACACCGACATGCCGGCCAAGATGCAGCTGCA 137 Query 70 GGCCATGAACGCCGCCTCTCACGCGCTCGATCTGTTCGACGTCGCGGACTGCAAGAGCCT 129 ||||| || || || |||||||| | ||||||||| |||||| |||| | Sbjct 138 GGCCACCTCGGCGGCGTCCAGGGCGCTCGAACGCTTCGACGTCCTCGACTGCCGGAGCAT 197 Query 130 CGCCGCGCATATCAAGAAGGAATTTGATAAGATCTACGGTCCGGGATGGCAGTGCGTCGT 189 ||| ||||| ||||||||||| || || | |||| |||| ||||| ||||||||||| || Sbjct 198 CGCGGCGCACATCAAGAAGGAGTTCGACACGATCCACGGCCCGGGGTGGCAGTGCGTGGT 257 Query 190 CGGCTCCAGCTTCGGCTGTTTCTTCACTCACAAGAAAGGCAGCTTCATCTACTTCCGCCT 249 |||| |||||||||||| | |||||| |||| || || |||||||| |||||| || Sbjct 258 GGGCTGCAGCTTCGGCTGCTACTTCACGCACAGCAAGGGGAGCTTCATATACTTCAAGCT 317 Query 250 GGAGACGCTCCACTTCCTCATCTTCAAAGGC 280 ||| |||||| |||||| ||||||||||| Sbjct 318 CGAGTCGCTCCGGTTCCTCGTCTTCAAAGGC 348 Alignment of the third best match to EX1.14 p. 7-14 © 2014 WSSP

26 p. 7-14 Alignments near the end of the EX1.13 >gi|254826767|ref|NG_012498.1| Homo sapiens glypican 4 (GPC4), RefSeqGene on chromosome X Length=121142 Score = 71.6 bits (78), Expect = 6e-09 Identities = 42/44 (95%), Gaps = 0/44 (0%)gi|254826767|ref|NG_012498.1| Query 665 CTAGCTTTTCTTAACaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 708 || ||||||||||| ||||||||||||||||||||||||||||| Sbjct 72886 CTTGCTTTTCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 72929 © 2014 WSSP

27 Question: Is this match biologically significant? A)Yes B)No C)Can not tell from data © 2014 WSSP

28 A)Yes B)No C)Can not tell from data Question: Is this match biologically significant? © 2014 WSSP

29 Clicker Question: Is this match likely in a protein coding region? A)Yes B)No C)Can not tell from data © 2014 WSSP

30 Clicker Question: What is the likely explanation for the gap? A)Sequence error in cDNA B)Error in making the cDNA C)Start of an intron region D)Can not tell from data E)A, B or C © 2014 WSSP

31 Clicker Question: Is this match likely in a protein coding region? A)Yes B)No C)Can not tell from data © 2014 WSSP

32 p. 7-15 Fill in the table listing the best matches from three different organisms. List Landoltia if there is a match © 2014 WSSP

33 Use the clone report to obtain more information about the gene p. 7-15 © 2014 WSSP

34 Is this a signific ant match? a)Yes b)No p. 7-16 © 2014 WSSP

35 3) Perform a BLASTn of the est database Change the database p. 7-17 © 2014 WSSP

36 p. 7-17 BLASTn report of the EX1.14 search of the est database © 2014 WSSP

37 >gi|198335694|gb|GD004539.1| CCHY28888.g1 CCHY Panicum virgatum callus (N) Panicum virgatumgi|198335694|gb|GD004539.1| cDNA clone CCHY28888 3', mRNA sequence. Length=624 Score = 246 bits (272), Expect = 1e-61 Identities = 226/286 (79%), Gaps = 0/286 (0%) Strand=Plus/Minus Query 3 GAGAGAAGATGTTGGAAGGGAGGGCGAGAGTAGAAGACACCGACATGCCGAGGAAGATGC 62 |||| | ||| ||||||||| ||||| || || ||||| ||||||||| |||||||| Sbjct 527 GAGACACCATGCTGGAAGGGAAGGCGATGGTGGAGGACACGGACATGCCGGCGAAGATGC 468 Query 63 AGGCGGAGGCCATGAACGCCGCCTCTCACGCGCTCGATCTGTTCGACGTCGCGGACTGCA 122 ||||| |||| ||| || || || || ||||| | ||||||||| |||||| Sbjct 467 AGGCGCAGGCGATGGCGGCGGCGTCCAGGGCCCTCGACCGCTTCGACGTCCTCGACTGCC 408 Query 123 AGAGCCTCGCCGCGCATATCAAGAAGGAATTTGATAAGATCTACGGTCCGGGATGGCAGT 182 |||| |||| ||||| ||||||||||| ||||| | |||| |||| || || ||||| | Sbjct 407 GGAGCATCGCGGCGCACATCAAGAAGGAGTTTGACACGATCCACGGCCCCGGGTGGCAAT 348 Query 183 GCGTCGTCGGCTCCAGCTTCGGCTGTTTCTTCACTCACAAGAAAGGCAGCTTCATCTACT 242 |||| || ||||||||||||||||| | |||||| |||| || || ||||||||||||| Sbjct 347 GCGTGGTGGGCTCCAGCTTCGGCTGCTACTTCACGCACAGCAAGGGGAGCTTCATCTACT 288 Query 243 TCCGCCTGGAGACGCTCCACTTCCTCATCTTCAAAGGCGCGGCCGC 288 |||| || ||| ||||| ||||||||||||||||| ||||| || Sbjct 287 TCCGGCTCGAGTCGCTCAGGTTCCTCATCTTCAAAGGGGCGGCAGC 242 Alignment of the best match to EX1.13 from the est search p. 7-17 © 2014 WSSP

38 Fill out the DSAP table of the BLASTn search of the est database p. 7-18 © 2014 WSSP

39 Query 61 CAAGGTCTAAGTACTGAAAAGGAAAGTCTACTAATTACAAAGAAGTTATTGTTTGTACCT 120 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct 13166 CAAGGTCTAAGTACTGAAAAGGAAAGTCCACTAATTACAAAGAAGTTATTGTTTGTACCT 13107 Query 121 TTTGTATCAGGGTTTATTAAATTTCAATCTTTATTGCTGAATCCCGAAACAAGGTGATCT 180 |||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| Sbjct 13106 TTTGTATCAGGGTTTATTAAATTTTAATCTTCATTGCTGAATCCCGAAACAAGGTGATCT 13047 Open Question: Why are there differences in the sequences? © 2014 WSSP

40 Q5. BLASTn Analysis: Is your cDNA similar to genes in other organisms? p. 7-16 © 2014 WSSP

41 Q6. BLASTn Analysis: Is your cDNA similar to genes in different kingdoms? p. 7-16 © 2014 WSSP i.e. are there any matches to organisms from the eubacteria, archabacteria, protist, fungi, or animal kingdoms or are they all matches to other plants?

42 ! Is the sequence found in many other organisms? © 2014 WSSP

43

Download ppt "WSSP Chapter 7 BLASTN: DNA vs DNA searches atttaccgtg ttggattgaa attatcttgc atgagccagc tgatgagtat gatacagttt tccgtattaa taacgaacgg ccggaaatag gatcccgatc."

Similar presentations

Blast outputoutput. How to measure the similarity between two sequences Q: which one is a better match to the query ? Query: M A T W L Seq_A: M A T P.

Blast outputoutput. How to measure the similarity between two sequences Q: which one is a better match to the query ? Query: M A T W L Seq_A: M A T P.
Bioinformatics. Bioinformatics is an applied science that uses computer programs to access molecular biology databanks to make inferences about the information.

Bioinformatics. Bioinformatics is an applied science that uses computer programs to access molecular biology databanks to make inferences about the information.
Bioinformatics Tutorial I BLAST and Sequence Alignment.

Bioinformatics Tutorial I BLAST and Sequence Alignment.
Max BachourJessica Chen. Shotgun or 454 sequencing High throughput sequencing technique that can collect a large amount of data at a fast rate. Works.

Max BachourJessica Chen. Shotgun or 454 sequencing High throughput sequencing technique that can collect a large amount of data at a fast rate. Works.
Bioinformatics Unit 1: Data Bases and Alignments Lecture 2: “Homology” Searches and Sequence Alignments.

Bioinformatics Unit 1: Data Bases and Alignments Lecture 2: “Homology” Searches and Sequence Alignments.
Expect value Expect value (E-value) Expected number of hits, of equivalent or better score, found by random chance in a database of the size.

Expect value Expect value (E-value) Expected number of hits, of equivalent or better score, found by random chance in a database of the size.
Review of Laboratory 3 Spectrophotometric determination of DNA quantity, purity Abs 260 nmAbs 280 nmAbs 320 nmAbs 260/Abs 280 0.05241 0.03110 0.00261 1.75.

Review of Laboratory 3 Spectrophotometric determination of DNA quantity, purity Abs 260 nmAbs 280 nmAbs 320 nmAbs 260/Abs
Sequence Analysis. Today How to retrieve a DNA sequence? How to search for other related DNA sequences? How to search for its protein sequence? How to.

Sequence Analysis. Today How to retrieve a DNA sequence? How to search for other related DNA sequences? How to search for its protein sequence? How to.
Using BLAST options to refine a search 1)Address the question “how many of the Phytophthora/tomato interaction ESTs are tomato?” A: Will depend on conditions.

Using BLAST options to refine a search 1)Address the question “how many of the Phytophthora/tomato interaction ESTs are tomato?” A: Will depend on conditions.
Genome Evolution: Duplication (Paralogs) & Degradation (Pseudogenes)

Genome Evolution: Duplication (Paralogs) & Degradation (Pseudogenes)
Arabidopsis Gene Project GK-12 April Workshop Karolyn Giang and Dr. Mulligan.

Arabidopsis Gene Project GK-12 April Workshop Karolyn Giang and Dr. Mulligan.
BLAT – The B LAST- L ike A lignment T ool Kent, W.J. Genome Res. 2002 12: 656-664 Presenter: 巨彥霖 田知本.

BLAT – The B LAST- L ike A lignment T ool Kent, W.J. Genome Res : Presenter: 巨彥霖 田知本.
Pairwise Alignment How do we tell whether two sequences are similar? BIO520 BioinformaticsJim Lund Assigned reading: Ch 4.1-4.7, Ch 5.1, get what you can.

Pairwise Alignment How do we tell whether two sequences are similar? BIO520 BioinformaticsJim Lund Assigned reading: Ch , Ch 5.1, get what you can.
An Introduction to Bioinformatics

An Introduction to Bioinformatics
Basic Introduction of BLAST Jundi Wang School of Computing CSC691 09/08/2013.

Basic Introduction of BLAST Jundi Wang School of Computing CSC691 09/08/2013.
Bikash Shakya Emma Lang Jorge Diaz.  BLASTx entire sequence against 9 plant genomes. RepeatMasker  55.47% repetitive sequences  82.5% retroelements.

Bikash Shakya Emma Lang Jorge Diaz.  BLASTx entire sequence against 9 plant genomes. RepeatMasker  55.47% repetitive sequences  82.5% retroelements.
What is comparative genomics? Analyzing & comparing genetic material from different species to study evolution, gene function, and inherited disease Understand.

What is comparative genomics? Analyzing & comparing genetic material from different species to study evolution, gene function, and inherited disease Understand.
WSSP Chapter 7 BLASTN: DNA vs DNA searches atttaccgtg ttggattgaa attatcttgc atgagccagc tgatgagtat gatacagttt tccgtattaa taacgaacgg ccggaaatag gatcccgatc.

WSSP Chapter 7 BLASTN: DNA vs DNA searches atttaccgtg ttggattgaa attatcttgc atgagccagc tgatgagtat gatacagttt tccgtattaa taacgaacgg ccggaaatag gatcccgatc.
Introduction to Bioinformatics CPSC 265. Interface of biology and computer science Analysis of proteins, genes and genomes using computer algorithms and.

Introduction to Bioinformatics CPSC 265. Interface of biology and computer science Analysis of proteins, genes and genomes using computer algorithms and.
Tweaking BLAST Although you normally see BLAST as a web page with boxes to place data in and tick boxes, etc., it is actually a command line program that.

Tweaking BLAST Although you normally see BLAST as a web page with boxes to place data in and tick boxes, etc., it is actually a command line program that.

Similar presentations

Ads by Google